Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Flavobacteria

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode:
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Blattabacterium sp. (Blattella germanica) str. Bge
Candidatus Sulcia muelleri SMDSEM
Capnocytophaga ochracea DSM 7271
Cellulophaga sp. MED134
Croceibacter atlanticus HTCC2559
Flavobacteria bacterium BAL38
Flavobacteria bacterium BBFL7
Flavobacteriaceae bacterium 3519-10
Flavobacteriales bacterium ALC-1
Flavobacteriales bacterium HTCC2170
Flavobacterium johnsoniae UW101
Flavobacterium psychrophilum JIP02/86
Gramella forsetii KT0803 9 1
Kordia algicida OT-1
Leeuwenhoekiella blandensis MED217 8 1
Polaribacter irgensii 23-P
Psychroflexus torquis ATCC 700755
Robiginitalea biformata HTCC2501
Tenacibaculum sp. MED152
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscS
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170
 
Flavobacterium johnsoniae UW101
 
Flavobacterium psychrophilum JIP02/86
*
Gramella forsetii KT0803

Site:
position = -33
score = 6.76833
sequence = CGATATATATACAAATACATAACG

Gene: orf441: Cysteine desulfurase (EC 2.8.1.7)
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
Cysteine desulfurase (EC 2.8.1.7)
orf442
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170
 
Flavobacterium johnsoniae UW101
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf442: Putative dehydrogenase
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
Putative dehydrogenase
mobA
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170

Gene: FB2170_09371: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Flavobacterium johnsoniae UW101
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf443: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217

Gene: MED217_08755: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Polaribacter irgensii 23-P

Gene: PI23P_04357: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501

Gene: RB2501_14939: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Tenacibaculum sp. MED152
Molybdopterin-guanine dinucleotide biosynthesis protein MobA
moaD
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170

Gene: FB2170_09351: Molybdenum cofactor biosynthesis protein MoaD
 
Flavobacterium johnsoniae UW101

Gene: Fjoh_4640: Molybdenum cofactor biosynthesis protein MoaD
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf444: Molybdenum cofactor biosynthesis protein MoaD
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217

Gene: MED217_08750: Molybdenum cofactor biosynthesis protein MoaD
 
Polaribacter irgensii 23-P

Gene: PI23P_03317: Molybdenum cofactor biosynthesis protein MoaD
 
Psychroflexus torquis ATCC 700755

Gene: P700755_31020: Molybdenum cofactor biosynthesis protein MoaD
 
Robiginitalea biformata HTCC2501

Gene: RB2501_14949: Molybdenum cofactor biosynthesis protein MoaD
 
Tenacibaculum sp. MED152
Molybdenum cofactor biosynthesis protein MoaD
moeB
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170

Gene: FB2170_09376: Molybdopterin biosynthesis protein MoeB
 
Flavobacterium johnsoniae UW101

Gene: Fjoh_4639: Molybdopterin biosynthesis protein MoeB
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf445: Molybdopterin biosynthesis protein MoeB
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217

Gene: MED217_08745: Molybdopterin biosynthesis protein MoeB
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501

Gene: RB2501_14934: Molybdopterin biosynthesis protein MoeB
 
Tenacibaculum sp. MED152
Molybdopterin biosynthesis protein MoeB
moaE
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170

Gene: FB2170_09356: Molybdenum cofactor biosynthesis protein MoaE
 
Flavobacterium johnsoniae UW101

Gene: Fjoh_4638: Molybdenum cofactor biosynthesis protein MoaE
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf446: Molybdenum cofactor biosynthesis protein MoaE
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217

Gene: MED217_08740: Molybdenum cofactor biosynthesis protein MoaE
 
Polaribacter irgensii 23-P

Gene: PI23P_03307: Molybdenum cofactor biosynthesis protein MoaE
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
Molybdenum cofactor biosynthesis protein MoaE
moaCB
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170
 
Flavobacterium johnsoniae UW101

Gene: Fjoh_4637: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf447: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217

Gene: MED217_08735: Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
Molybdenum cofactor biosynthesis fusion protein MoaC/MoaB
moaA
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170

Gene: FB2170_09361: Molybdenum cofactor biosynthesis protein MoaA
 
Flavobacterium johnsoniae UW101

Gene: Fjoh_4636: Molybdenum cofactor biosynthesis protein MoaA
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf448: Molybdenum cofactor biosynthesis protein MoaA
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217

Gene: MED217_08730: Molybdenum cofactor biosynthesis protein MoaA
 
Polaribacter irgensii 23-P

Gene: PI23P_04332: Molybdenum cofactor biosynthesis protein MoaA
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501

Gene: RB2501_14944: Molybdenum cofactor biosynthesis protein MoaA
 
Tenacibaculum sp. MED152

Gene: MED152_09580: Molybdenum cofactor biosynthesis protein MoaA
Molybdenum cofactor biosynthesis protein MoaA
moeA
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170
 
Flavobacterium johnsoniae UW101

Gene: Fjoh_4644: Molybdopterin biosynthesis protein MoeA
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf449: Molybdopterin biosynthesis protein MoeA
 
Kordia algicida OT-1
*
Leeuwenhoekiella blandensis MED217

Site:
position = -33
score = 6.76833
sequence = CGTTATATTCGCTAAAACATAACG

Gene: MED217_08765: Molybdopterin biosynthesis protein MoeA
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
Molybdopterin biosynthesis protein MoeA
modE2
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170
 
Flavobacterium johnsoniae UW101
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803

Gene: orf440: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217

Gene: MED217_08760: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
Molybdate-responsive transcriptional regulator ModE2, ModE family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD