Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR1 - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannose utilization; Mannosides utilization
Effector: Mannose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7 6 2
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B 6 2
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mnnA1
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
*
Shewanella sp MR-7

Site:
position = -76
score = 6.71543
sequence = AAATTGGAACGTTCCAAAAA

Gene: Shewmr7_3384: Alpha-1,2-mannosidase
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -76
score = 7.09642
sequence = AAATTGGAACGTTCCAATTG

Gene: Sama_0564: Alpha-1,2-mannosidase
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Alpha-1,2-mannosidase
mnnA2
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7

Gene: Shewmr7_3385: Alpha-1,2-mannosidase
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_0563: Alpha-1,2-mannosidase
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Alpha-1,2-mannosidase
manP1
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7

Gene: Shewmr7_3386: Predicted mannose transporter, GGP family
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_0562: Predicted mannose transporter, GGP family
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Predicted mannose transporter, GGP family
manK
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7

Gene: Shewmr7_3387: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_0561: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
manI
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7

Gene: Shewmr7_3388: D-mannose isomerase (EC 5.3.1.7)
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_0560: D-mannose isomerase (EC 5.3.1.7)
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
D-mannose isomerase (EC 5.3.1.7)
 
CRON 2.
manR1
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
*
Shewanella sp MR-7

Site:
position = -103
score = 6.71543
sequence = TTTTTGGAACGTTCCAATTT

Gene: Shewmr7_3383: Transcriptional regulator of mannoside utilization, LacI family
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -103
score = 7.09642
sequence = CAATTGGAACGTTCCAATTT

Gene: Sama_0565: Transcriptional regulator of mannoside utilization, LacI family
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Transcriptional regulator of mannoside utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD