Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chromobacterium violaceum ATCC 12472
Laribacter hongkongensis HLHK9
Neisseria meningitidis MC58
Methylobacillus flagellatus KT 5 2
Methylophilales bacterium HTCC2181
Methylotenera mobilis JLW8 5 2
Thiobacillus denitrificans
Nitrosospira multiformis ATCC 25196
Nitrosomonas europaea ATCC 19718
Azoarcus sp. EbN1
Dechloromonas aromatica RCB
Thauera sp. MZ1T
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
moaA
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
*
Methylobacillus flagellatus KT

Site:
position = -48
score = 6.01121
sequence = TGTTAGTATTGACCGAAGGACTTACA

Gene: Mfla_2294: Molybdenum cofactor biosynthesis protein MoaA
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01935: Molybdenum cofactor biosynthesis protein MoaA
 
Methylotenera mobilis JLW8

Gene: Mmol_2036: Molybdenum cofactor biosynthesis protein MoaA
 
Thiobacillus denitrificans
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB

Gene: Daro_1999: Molybdenum cofactor biosynthesis protein MoaA
 
Thauera sp. MZ1T
Molybdenum cofactor biosynthesis protein MoaA
mobA
 
Chromobacterium violaceum ATCC 12472

Gene: CV1625: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Laribacter hongkongensis HLHK9

Gene: LHK_00039: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Neisseria meningitidis MC58
 
Methylobacillus flagellatus KT

Gene: Mfla_2295: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01930: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Methylotenera mobilis JLW8

Gene: Mmol_2037: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Thiobacillus denitrificans
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Molybdopterin-guanine dinucleotide biosynthesis protein MobA
mobB
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
 
Methylobacillus flagellatus KT

Gene: Mfla_2296: Molybdopterin-guanine dinucleotide biosynthesis protein MobB
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01925: Molybdopterin-guanine dinucleotide biosynthesis protein MobB
 
Methylotenera mobilis JLW8
 
Thiobacillus denitrificans
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Molybdopterin-guanine dinucleotide biosynthesis protein MobB
moeA
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
 
Methylobacillus flagellatus KT

Gene: Mfla_2297: Molybdopterin biosynthesis protein MoeA
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01920: Molybdopterin biosynthesis protein MoeA
 
Methylotenera mobilis JLW8

Gene: Mmol_2038: Molybdopterin biosynthesis protein MoeA
 
Thiobacillus denitrificans
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1

Gene: ebA1078: Molybdopterin biosynthesis protein MoeA
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T

Gene: Tmz1t_1527: Molybdopterin biosynthesis protein MoeA
Molybdopterin biosynthesis protein MoeA
 
CRON 2.
Mfla_0622
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
 
Methylobacillus flagellatus KT

Gene: Mfla_0622: Conserved hypothetical protein
 
Methylophilales bacterium HTCC2181
*
Methylotenera mobilis JLW8

Site:
position = -139
score = 6.42889
sequence = TGTGATTAAATTGCACATTATTCAAA

Gene: Mmol_2127: Conserved hypothetical protein
 
Thiobacillus denitrificans
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Conserved hypothetical protein
modA
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8

Gene: Mmol_2128: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Thiobacillus denitrificans

Gene: Tbd_1283: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1

Gene: ebA2721: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T

Gene: Tmz1t_0536: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8

Gene: Mmol_2129: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Thiobacillus denitrificans

Gene: Tbd_1284: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1

Gene: ebA2720: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Dechloromonas aromatica RCB

Gene: Daro_2783: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Thauera sp. MZ1T

Gene: Tmz1t_0537: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8

Gene: Mmol_2130: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Thiobacillus denitrificans

Gene: Tbd_1285: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1

Gene: ebA2719: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Dechloromonas aromatica RCB

Gene: Daro_2784: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Thauera sp. MZ1T

Gene: Tmz1t_0538: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
CRON 3.
modE2
 
Chromobacterium violaceum ATCC 12472
 
Laribacter hongkongensis HLHK9
 
Neisseria meningitidis MC58
*
Methylobacillus flagellatus KT

Site:
position = -79
score = 6.01121
sequence = TGTAAGTCCTTCGGTCAATACTAACA

Gene: Mfla_2293: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Methylophilales bacterium HTCC2181
*
Methylotenera mobilis JLW8

Site:
position = -147
score = 6.42889
sequence = TTTGAATAATGTGCAATTTAATCACA

Gene: Mmol_2126: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Thiobacillus denitrificans
 
Nitrosospira multiformis ATCC 25196
 
Nitrosomonas europaea ATCC 19718
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
Molybdate-responsive transcriptional regulator ModE2, ModE family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD