Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1 3 2
Delftia acidovorans SPH-1 4 2
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666 4 2
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110 3 1
Verminephrobacter eiseniae EF01-2 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modB
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0893: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Delftia acidovorans SPH-1

Gene: Daci_3882: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_2498: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -14
score = 5.54595
sequence = TGCGTTGTATCTTCATGAATACGACGAA

Gene: Vapar_4070: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Verminephrobacter eiseniae EF01-2
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -68
score = 5.88236
sequence = AGTGTTATATTCCGTCAAATATAACGTG

Gene: CtesDRAFT_0892: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Delftia acidovorans SPH-1

Site:
position = -75
score = 5.69438
sequence = TTCATCGTATACGATTGAATATTTCGTA

Gene: Daci_3883: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -99
score = 6.93968
sequence = TTCGCTATATTCCATTAAATATAGCGAA

Gene: Bpro_2497: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4069: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Verminephrobacter eiseniae EF01-2
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666

Gene: Bpro_2499: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4068: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Verminephrobacter eiseniae EF01-2
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
CRON 2.
modE2
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_0896: Molybdate-responsive transcriptional regulator ModE2, ModE family
*
Delftia acidovorans SPH-1

Site:
position = -60
score = 4.23549
sequence = TTCGCTGTAGCGATCCATGCATTGCGTA

Gene: Daci_4259: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -103
score = 6.93968
sequence = TTCGCTATATTTAATGGAATATAGCGAA

Gene: Bpro_2496: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_4071: Molybdate-responsive transcriptional regulator ModE2, ModE family
*
Verminephrobacter eiseniae EF01-2

Site:
position = -212
score = 6.00212
sequence = TACGTCGTATTCCATCGGATATGTCAAA

Gene: Veis_3515: Molybdate-responsive transcriptional regulator ModE2, ModE family
Molybdate-responsive transcriptional regulator ModE2, ModE family
COG1720
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
*
Comamonas testosteroni KF-1

Site:
position = -50
score = 5.88236
sequence = CACGTTATATTTGACGGAATATAACACT

Gene: CtesDRAFT_0891: Conserved hypothetical protein
 
Delftia acidovorans SPH-1

Gene: Daci_4260: Conserved hypothetical protein
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Conserved hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD