Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE2 - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode:
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia cepacia AMMD
Burkholderia glumae BGR1 5 2
Burkholderia mallei ATCC 23344
Burkholderia phymatum STM815
Burkholderia pseudomallei K96243
Burkholderia sp. 383 4 2
Burkholderia vietnamiensis G4 8 4
Burkholderia xenovorans LB400 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mopI
 
Burkholderia cepacia AMMD

Gene: Bamb_6011: Molybdopterin-binding protein
*
Burkholderia glumae BGR1

Site:
position = -140
score = 6.2212
sequence = CGTTGTAAAGGTCGGTATATTACG

Gene: bglu_2g05490: Molybdopterin-binding protein
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_5363: Molybdopterin-binding protein
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -180
score = 5.8953
sequence = CGTTATCACCTTCAGTACATAACG

Gene: Bcep18194_C7726: Molybdopterin-binding protein
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_5471: Molybdopterin-binding protein
 
Burkholderia xenovorans LB400
Molybdopterin-binding protein
Bxe_B1193
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1

Gene: bglu_2g05500: Conserved hypothetical protein
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
*
Burkholderia sp. 383

Site:
position = -62
score = 5.65527
sequence = CGTAATATACCCGTCGATACAACG

Gene: Bcep18194_B2795: Conserved hypothetical protein
 
Burkholderia vietnamiensis G4
*
Burkholderia xenovorans LB400

Site:
position = -67
score = 6.10338
sequence = CGTAATATACACACGGACATAACG

Gene: Bxe_B1192: Conserved hypothetical protein
Conserved hypothetical protein
modE2
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1

Gene: bglu_2g05510: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_B2794: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_7293: Molybdate-responsive transcriptional regulator ModE2, ModE family
 
Burkholderia xenovorans LB400

Gene: Bxe_B1193: Molybdate-responsive transcriptional regulator ModE2, ModE family
Molybdate-responsive transcriptional regulator ModE2, ModE family
nifQ
 
Burkholderia cepacia AMMD
 
Burkholderia glumae BGR1
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383

Gene: Bcep18194_C7727: Nitrogenase FeMo-cofactor synthesis molybdenum delivery protein NifQ
 
Burkholderia vietnamiensis G4
 
Burkholderia xenovorans LB400
Nitrogenase FeMo-cofactor synthesis molybdenum delivery protein NifQ
 
CRON 2.
modA2
 
Burkholderia cepacia AMMD
*
Burkholderia glumae BGR1

Site:
position = -38
score = 6.2212
sequence = CGTAATATACCGACCTTTACAACG

Gene: bglu_2g05480: Molybdate ABC transporter, substrate-binding protein
 
Burkholderia mallei ATCC 23344
 
Burkholderia phymatum STM815

Gene: Bphy_5150: Molybdate ABC transporter, substrate-binding protein
 
Burkholderia pseudomallei K96243
 
Burkholderia sp. 383
*4
Burkholderia vietnamiensis G4

Site:
position = -41
score = 6.54952
sequence = CGTAATATACGTAACTTCATAACG

Gene: Bcep1808_6097: Molybdate ABC transporter, substrate-binding protein

Site:
position = -41
score = 6.54952
sequence = CGTAATATACGTAACTTCATAACG

Gene: Bcep1808_6644: Molybdate ABC transporter, substrate-binding protein

Site:
position = -41
score = 6.54952
sequence = CGTAATATACGTAACTTCATAACG

Gene: Bcep1808_1646: Molybdate ABC transporter, substrate-binding protein

Site:
position = -41
score = 6.54952
sequence = CGTAATATACGTAACTTCATAACG

Gene: Bcep1808_7470: Molybdate ABC transporter, substrate-binding protein
*
Burkholderia xenovorans LB400

Site:
position = -40
score = 5.87824
sequence = CGTAATATAGCGCTCTTAATAACG

Gene: Bxe_B1190: Molybdate ABC transporter, substrate-binding protein
Molybdate ABC transporter, substrate-binding protein
modCB2
 
Burkholderia cepacia AMMD

Gene: Bamb_3863: Molybdate ABC transporter, ATP-binding/permease fused protein
 
Burkholderia glumae BGR1

Gene: bglu_2g05470: Molybdate ABC transporter, ATP-binding/permease fused protein
 
Burkholderia mallei ATCC 23344

Gene: BMAA1688: Molybdate ABC transporter, ATP-binding/permease fused protein
 
Burkholderia phymatum STM815

Gene: Bphy_5151: Molybdate ABC transporter, ATP-binding/permease fused protein
 
Burkholderia pseudomallei K96243

Gene: BPSS1671: Molybdate ABC transporter, ATP-binding/permease fused protein
 
Burkholderia sp. 383
 4
Burkholderia vietnamiensis G4

Gene: Bcep1808_6645: Molybdate ABC transporter, ATP-binding/permease fused protein

Gene: Bcep1808_1645: Molybdate ABC transporter, ATP-binding/permease fused protein

Gene: Bcep1808_7469: Molybdate ABC transporter, ATP-binding/permease fused protein

Gene: Bcep1808_6096: Molybdate ABC transporter, ATP-binding/permease fused protein
 
Burkholderia xenovorans LB400

Gene: Bxe_B1189: Molybdate ABC transporter, ATP-binding/permease fused protein
Molybdate ABC transporter, ATP-binding/permease fused protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD