Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE3 - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42 8 2
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1
Leptothrix cholodnii SP-6 12 2
Methylibium petroleiphilum PM1 4 1
Polaromonas naphthalenivorans CJ2 8 2
Polaromonas sp. JS666 10 2
Rhodoferax ferrireducens DSM 15236 10 2
Variovorax paradoxus S110 3 1
Verminephrobacter eiseniae EF01-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Ajs_3943
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -65
score = 6.44664
sequence = CTATGCAAATCTTTTCATAG

Gene: Ajs_3943: NADH-dependent dehydrogenase, iron-sulfur binding protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
*
Leptothrix cholodnii SP-6

Site:
position = -91
score = 6.17166
sequence = CTATGCAGATGATTGCATAG

Gene: Lcho_1816: NADH-dependent dehydrogenase, iron-sulfur binding protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2582: NADH-dependent dehydrogenase, iron-sulfur binding protein
*
Polaromonas naphthalenivorans CJ2

Site:
position = -60
score = 5.94604
sequence = CTATGCAAATCAATTCATAG

Gene: Pnap_0048: NADH-dependent dehydrogenase, iron-sulfur binding protein
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2851: NADH-dependent dehydrogenase, iron-sulfur binding protein
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
NADH-dependent dehydrogenase, iron-sulfur binding protein
Ajs_3944
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3944: Tungsten-containing aldehyde ferredoxin oxidoreductase
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1817: Tungsten-containing aldehyde ferredoxin oxidoreductase
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2581: Tungsten-containing aldehyde ferredoxin oxidoreductase
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0049: Tungsten-containing aldehyde ferredoxin oxidoreductase
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2850: Tungsten-containing aldehyde ferredoxin oxidoreductase
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Tungsten-containing aldehyde ferredoxin oxidoreductase
Ajs_3945
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3945: NADH-dependent dehydrogenase, NADH-binding subunit
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1818: NADH-dependent dehydrogenase, NADH-binding subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2580: NADH-dependent dehydrogenase, NADH-binding subunit
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0050: NADH-dependent dehydrogenase, NADH-binding subunit
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2849: NADH-dependent dehydrogenase, NADH-binding subunit
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
NADH-dependent dehydrogenase, NADH-binding subunit
Ajs_3946
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3946: Conserved hypothetical protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1819: Conserved hypothetical protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2579: Conserved hypothetical protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0051: Conserved hypothetical protein
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2848: Conserved hypothetical protein
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Conserved hypothetical protein
Ajs_3947
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3947: Conserved hypothetical protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1820: Conserved hypothetical protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2578: Conserved hypothetical protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0052: Conserved hypothetical protein
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2847: Conserved hypothetical protein
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Conserved hypothetical protein
 
CRON 2.
fdoX
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
*
Leptothrix cholodnii SP-6

Site:
position = -39
score = 5.52393
sequence = ATATGCAGGCCTTTGCATGG

Gene: Lcho_3729: Putative subunit of formate dehydrogenase
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
*
Polaromonas sp. JS666

Site:
position = -48
score = 5.84447
sequence = GTATGCAAACCGTTGCATAC

Gene: Bpro_0936: Putative subunit of formate dehydrogenase
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -41
score = 6.12726
sequence = CTATGCAAATAGTTGCATAA

Gene: Rfer_3262: Putative subunit of formate dehydrogenase
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Putative subunit of formate dehydrogenase
fdoG
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3464: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3728: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1170: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0834: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
 
Polaromonas sp. JS666

Gene: Bpro_0937: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3261: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
fdoH
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3463: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3727: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1171: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0835: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
 
Polaromonas sp. JS666

Gene: Bpro_0938: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3260: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
fdoY
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3462: Putative subunit of formate dehydrogenase
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3726: Putative subunit of formate dehydrogenase
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1172: Putative subunit of formate dehydrogenase
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0836: Putative subunit of formate dehydrogenase
 
Polaromonas sp. JS666

Gene: Bpro_0939: Putative subunit of formate dehydrogenase
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3259: Putative subunit of formate dehydrogenase
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Putative subunit of formate dehydrogenase
fdoI
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3461: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3725: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1173: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0837: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
 
Polaromonas sp. JS666

Gene: Bpro_0940: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3258: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
fdoZ
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3460: Putative subunit of formate dehydrogenase
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3724: Putative subunit of formate dehydrogenase
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1174: Putative subunit of formate dehydrogenase
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0838: Putative subunit of formate dehydrogenase
 
Polaromonas sp. JS666

Gene: Bpro_0941: Putative subunit of formate dehydrogenase
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3257: Putative subunit of formate dehydrogenase
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Putative subunit of formate dehydrogenase
fdhD
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3459: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_3723: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1176: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0839: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Polaromonas sp. JS666

Gene: Bpro_0942: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3256: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Formate dehydrogenase chain D (EC 1.2.1.2)
 
CRON 3.
tupA
 
Acidovorax avenae subsp. citrulli AAC00-1
*
Acidovorax sp. JS42

Site:
position = -58
score = 5.91135
sequence = CTATGCACAAGTTTTCATAT

Gene: Ajs_3129: Tungstate ABC-type transporter, permease protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1813: Tungstate ABC-type transporter, permease protein
*
Methylibium petroleiphilum PM1

Site:
position = -102
score = 5.32755
sequence = CTATGCATGCTCGTTCATAT

Gene: Mpe_A2223: Tungstate ABC-type transporter, permease protein
*
Polaromonas naphthalenivorans CJ2

Site:
position = -84
score = 5.75948
sequence = CTATGCAAACAGCTTCATAA

Gene: Pnap_1509: Tungstate ABC-type transporter, permease protein
*
Polaromonas sp. JS666

Site:
position = -85
score = 5.76943
sequence = CTATGCAAACCCATTCATAA

Gene: Bpro_1758: Tungstate ABC-type transporter, permease protein
*
Rhodoferax ferrireducens DSM 15236

Site:
position = -58
score = 5.22138
sequence = CTATGCACGGTGGTTCATAT

Gene: Rfer_2869: Tungstate ABC-type transporter, permease protein
*
Variovorax paradoxus S110

Site:
position = -74
score = 6.06821
sequence = CTATGCAAAATCCTGCATAG

Gene: Vapar_1588: Tungstate ABC-type transporter, permease protein
 
Verminephrobacter eiseniae EF01-2
Tungstate ABC-type transporter, permease protein
tupC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3128: Tungstate ABC-type transporter, ATP-binding protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1814: Tungstate ABC-type transporter, ATP-binding protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2222: Tungstate ABC-type transporter, ATP-binding protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1510: Tungstate ABC-type transporter, ATP-binding protein
 
Polaromonas sp. JS666

Gene: Bpro_1759: Tungstate ABC-type transporter, ATP-binding protein
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2868: Tungstate ABC-type transporter, ATP-binding protein
 
Variovorax paradoxus S110

Gene: Vapar_1589: Tungstate ABC-type transporter, ATP-binding protein
 
Verminephrobacter eiseniae EF01-2
Tungstate ABC-type transporter, ATP-binding protein
tupB
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42

Gene: Ajs_3127: Tungstate ABC-type transporter, substrate-binding protein
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_1815: Tungstate ABC-type transporter, substrate-binding protein
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2221: Tungstate ABC-type transporter, substrate-binding protein
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_1511: Tungstate ABC-type transporter, substrate-binding protein
 
Polaromonas sp. JS666

Gene: Bpro_1760: Tungstate ABC-type transporter, substrate-binding protein
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_2867: Tungstate ABC-type transporter, substrate-binding protein
 
Variovorax paradoxus S110

Gene: Vapar_1590: Tungstate ABC-type transporter, substrate-binding protein
 
Verminephrobacter eiseniae EF01-2
Tungstate ABC-type transporter, substrate-binding protein
modA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1

Gene: Mpe_A2220: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD