Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FdsR - Burkholderia

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Burkholderia vietnamiensis G4 5 2
Burkholderia cepacia AMMD 5 2
Burkholderia glumae BGR1 5 2
Burkholderia mallei ATCC 23344 5 2
Burkholderia phymatum STM815 5 2
Burkholderia pseudomallei K96243 5 2
Burkholderia sp. 383 5 2
Burkholderia xenovorans LB400 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fdsR
*
Burkholderia vietnamiensis G4

Site:
position = -108
score = 4.69262
sequence = ATATGTGCCGGTAATTCATAT

Site:
position = -21
score = 5.7341
sequence = ATAGGAAATCGGAGTACATAA

Gene: Bcep1808_0955: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Burkholderia cepacia AMMD

Site:
position = -108
score = 5.32511
sequence = ATATGCGCTAGGAATGCATAT

Site:
position = -21
score = 6.03004
sequence = ATAGGAAATCGGAGTGCATAA

Gene: Bamb_0898: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Burkholderia glumae BGR1

Site:
position = -21
score = 5.26405
sequence = ATAAGAAATGAGGTTGCATAA

Gene: bglu_1g08610: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Burkholderia mallei ATCC 23344

Site:
position = -93
score = 5.7021
sequence = ATAGGAAACGGAATTGCATAA

Site:
position = -179
score = 4.74804
sequence = ATATGCGCTTATGATTCATAT

Gene: BMA0446: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Burkholderia phymatum STM815

Site:
position = -21
score = 4.96896
sequence = ATAGGAACTACAACAGCATAT

Site:
position = -111
score = 5.25112
sequence = ATATGCACTTGTTATTCATAA

Gene: Bphy_0730: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Burkholderia pseudomallei K96243

Site:
position = -21
score = 5.7021
sequence = ATAGGAAACGGAATTGCATAA

Site:
position = -107
score = 4.74804
sequence = ATATGCGCTTATGATTCATAT

Gene: BPSL2527: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Burkholderia sp. 383

Site:
position = -108
score = 5.18137
sequence = ATATGCGCTCGAGATTCATAT

Site:
position = -21
score = 6.03004
sequence = ATAGGAAATCGGAGTGCATAA

Gene: Bcep18194_A4147: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Burkholderia xenovorans LB400

Site:
position = -112
score = 5.32569
sequence = ATATGCACTTGTCATTCATAA

Gene: Bxe_A0967: Formate dehydrogenase transcriptional regulator FdsR, ModE family
Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
CRON 2.
fdsG
*
Burkholderia vietnamiensis G4

Site:
position = -131
score = 5.7341
sequence = TTATGTACTCCGATTTCCTAT

Site:
position = -44
score = 4.69262
sequence = ATATGAATTACCGGCACATAT

Gene: Bcep1808_0954: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Burkholderia cepacia AMMD

Site:
position = -44
score = 5.32511
sequence = ATATGCATTCCTAGCGCATAT

Site:
position = -131
score = 6.03004
sequence = TTATGCACTCCGATTTCCTAT

Gene: Bamb_0897: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Burkholderia glumae BGR1

Site:
position = -127
score = 5.26405
sequence = TTATGCAACCTCATTTCTTAT

Gene: bglu_1g08600: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Burkholderia mallei ATCC 23344

Site:
position = -44
score = 4.74804
sequence = ATATGAATCATAAGCGCATAT

Site:
position = -130
score = 5.7021
sequence = TTATGCAATTCCGTTTCCTAT

Gene: BMA0448: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Burkholderia phymatum STM815

Site:
position = -134
score = 4.96896
sequence = ATATGCTGTTGTAGTTCCTAT

Site:
position = -44
score = 5.25112
sequence = TTATGAATAACAAGTGCATAT

Gene: Bphy_0729: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Burkholderia pseudomallei K96243

Site:
position = -88
score = 5.7021
sequence = TTATGCAATTCCGTTTCCTAT

Gene: BPSL2528: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Burkholderia sp. 383

Site:
position = -131
score = 6.03004
sequence = TTATGCACTCCGATTTCCTAT

Site:
position = -44
score = 5.18137
sequence = ATATGAATCTCGAGCGCATAT

Gene: Bcep18194_A4146: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Burkholderia xenovorans LB400

Site:
position = -43
score = 5.32569
sequence = TTATGAATGACAAGTGCATAT

Gene: Bxe_A0966: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
fdsB
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0953: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Burkholderia cepacia AMMD

Gene: Bamb_0896: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Burkholderia glumae BGR1

Gene: bglu_1g08590: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Burkholderia mallei ATCC 23344

Gene: BMA0449: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Burkholderia phymatum STM815

Gene: Bphy_0728: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Burkholderia pseudomallei K96243

Gene: BPSL2529: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Burkholderia sp. 383

Gene: Bcep18194_A4145: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Burkholderia xenovorans LB400

Gene: Bxe_A0965: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
fdsA
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0952: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Burkholderia cepacia AMMD

Gene: Bamb_0895: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Burkholderia glumae BGR1

Gene: bglu_1g08580: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Burkholderia mallei ATCC 23344

Gene: BMA0450: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Burkholderia phymatum STM815

Gene: Bphy_0727: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Burkholderia pseudomallei K96243

Gene: BPSL2530: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Burkholderia sp. 383

Gene: Bcep18194_A4144: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Burkholderia xenovorans LB400

Gene: Bxe_A0964: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
fdsD
 
Burkholderia vietnamiensis G4

Gene: Bcep1808_0951: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Burkholderia cepacia AMMD

Gene: Bamb_0894: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Burkholderia glumae BGR1

Gene: bglu_1g08570: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Burkholderia mallei ATCC 23344

Gene: BMA0451: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Burkholderia phymatum STM815

Gene: Bphy_0726: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Burkholderia pseudomallei K96243

Gene: BPSL2531: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Burkholderia sp. 383

Gene: Bcep18194_A4143: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Burkholderia xenovorans LB400

Gene: Bxe_A0963: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD