Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FdsR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azotobacter vinelandii AvOP
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5
Pseudomonas mendocina ymp 5 2
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fdsR
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas fluorescens Pf-5
*
Pseudomonas mendocina ymp

Site:
position = -94
score = 5.99781
sequence = ATATGAAGTAAAGTTCTTAT

Site:
position = -18
score = 5.5722
sequence = ATATGAATCCTTGAACATAT

Gene: Pmen_0386: Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
Pseudomonas putida KT2440
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
CRON 2.
fdsG
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN1826: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0331: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Pseudomonas mendocina ymp

Site:
position = -124
score = 5.99781
sequence = ATAAGAACTTTACTTCATAT

Site:
position = -200
score = 5.5722
sequence = ATATGTTCAAGGATTCATAT

Gene: Pmen_0387: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Pseudomonas putida KT2440

Gene: PP2183: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
fdsB
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN1827: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0330: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Pseudomonas mendocina ymp

Gene: Pmen_0388: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Pseudomonas putida KT2440

Gene: PP2184: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
fdsA
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN1828: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0329: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Pseudomonas mendocina ymp

Gene: Pmen_0389: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Pseudomonas putida KT2440

Gene: PP2185: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
fdsD
 
Azotobacter vinelandii AvOP
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48

Gene: PSEEN1829: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0328: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Pseudomonas mendocina ymp

Gene: Pmen_0390: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Pseudomonas putida KT2440

Gene: PP2186: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Pseudomonas stutzeri A1501
 
Pseudomonas syringae pv. tomato str. DC3000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD