Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FdsR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Marinomonas sp. MWYL1
Chromohalobacter salexigens DSM 3043
Alcanivorax borkumensis SK2
Hahella chejuensis KCTC 2396
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Cellvibrio japonicus Ueda107
Marinobacter aqueolei
Marinobacter sp. ELB17 6 2
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fdsG
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2276: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Chromohalobacter salexigens DSM 3043
 
Alcanivorax borkumensis SK2
 
Hahella chejuensis KCTC 2396
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
*
Marinobacter sp. ELB17

Site:
position = -103
score = 5.78652
sequence = TTATGCAATTTTATTCATAT

Site:
position = -12
score = 5.97273
sequence = GTAGGAACAATTATGCATAT

Gene: MELB17_23340: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
fdsB
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2275: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Chromohalobacter salexigens DSM 3043
 
Alcanivorax borkumensis SK2
 
Hahella chejuensis KCTC 2396
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_23335: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
fdsA
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2274: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Chromohalobacter salexigens DSM 3043
 
Alcanivorax borkumensis SK2
 
Hahella chejuensis KCTC 2396
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_23330: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
fdsC
 
Marinomonas sp. MWYL1
 
Chromohalobacter salexigens DSM 3043
 
Alcanivorax borkumensis SK2
 
Hahella chejuensis KCTC 2396
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_23325: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
fdsD
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2273: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Chromohalobacter salexigens DSM 3043
 
Alcanivorax borkumensis SK2
 
Hahella chejuensis KCTC 2396
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_23320: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
CRON 2.
fdsR
 
Marinomonas sp. MWYL1
 
Chromohalobacter salexigens DSM 3043
 
Alcanivorax borkumensis SK2
 
Hahella chejuensis KCTC 2396
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Reinekea sp. MED297
 
Cellvibrio japonicus Ueda107
 
Marinobacter aqueolei
*
Marinobacter sp. ELB17

Site:
position = -103
score = 5.97273
sequence = ATATGCATAATTGTTCCTAC

Site:
position = -12
score = 5.78652
sequence = ATATGAATAAAATTGCATAA

Gene: MELB17_23345: Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
Formate dehydrogenase transcriptional regulator FdsR, ModE family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD