Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FdsR - Alcaligenaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bordetella avium 197N 8 2
Bordetella bronchiseptica RB50 7 2
Bordetella petrii DSM 12804 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fdsR
*
Bordetella avium 197N

Site:
position = -82
score = 5.94304
sequence = ATATGTTTATTTTTACATAT

Gene: BAV0819: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Bordetella bronchiseptica RB50

Site:
position = -88
score = 6.12781
sequence = ATATGTTATTCAGTACATAT

Gene: BB1324: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Bordetella petrii DSM 12804

Site:
position = -88
score = 6.06452
sequence = ATATGCTGTTAAAAACATAT

Gene: Bpet3682: Formate dehydrogenase transcriptional regulator FdsR, ModE family
Formate dehydrogenase transcriptional regulator FdsR, ModE family
moaA
 
Bordetella avium 197N

Gene: BAV0820: Molybdenum cofactor biosynthesis protein MoaA
 
Bordetella bronchiseptica RB50

Gene: BB1325: Molybdenum cofactor biosynthesis protein MoaA
 
Bordetella petrii DSM 12804

Gene: Bpet3681: Molybdenum cofactor biosynthesis protein MoaA
Molybdenum cofactor biosynthesis protein MoaA
mobA
 
Bordetella avium 197N

Gene: BAV0821: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
Bordetella bronchiseptica RB50
 
Bordetella petrii DSM 12804
Molybdopterin-guanine dinucleotide biosynthesis protein MobA
 
CRON 2.
fdsG
*
Bordetella avium 197N

Site:
position = -145
score = 5.86148
sequence = ATATGTTATTTCTTGCATAT

Site:
position = -65
score = 5.94304
sequence = ATATGTAAAAATAAACATAT

Gene: BAV0818: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Bordetella bronchiseptica RB50

Site:
position = -81
score = 6.12781
sequence = ATATGTACTGAATAACATAT

Site:
position = -158
score = 5.62082
sequence = ATATGTCATTTATTTCTTAT

Gene: BB1323: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Bordetella petrii DSM 12804

Site:
position = -95
score = 6.06452
sequence = ATATGTTTTTAACAGCATAT

Site:
position = -172
score = 5.80094
sequence = ATATGTCATTAATTTCTTAT

Gene: Bpet3683: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
fdsB
 
Bordetella avium 197N

Gene: BAV0817: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Bordetella bronchiseptica RB50

Gene: BB1322: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Bordetella petrii DSM 12804

Gene: Bpet3684: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
fdsA
 
Bordetella avium 197N

Gene: BAV0816: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Bordetella bronchiseptica RB50

Gene: BB1321: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Bordetella petrii DSM 12804

Gene: Bpet3685: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
fdsC
 
Bordetella avium 197N

Gene: BAV0815: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Bordetella bronchiseptica RB50

Gene: BB1320: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Bordetella petrii DSM 12804

Gene: Bpet3686: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
fdsD
 
Bordetella avium 197N

Gene: BAV0814: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Bordetella bronchiseptica RB50

Gene: BB1319: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Bordetella petrii DSM 12804

Gene: Bpet3687: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD