Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FdsR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1 4 2
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110 6 2
Verminephrobacter eiseniae EF01-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fdsG
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6

Gene: Lcho_2752: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Methylibium petroleiphilum PM1

Site:
position = -167
score = 5.75651
sequence = TTCGGCGCTTCAGCGCATAT

Gene: Mpe_A3708: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -119
score = 5.75651
sequence = TTCGGCTTTCCAAAGCATAT

Gene: Vapar_3017: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2385: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
fdsB
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2782: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Delftia acidovorans SPH-1

Gene: Daci_1860: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_2751: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A3709: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3018: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2384: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
fdsA
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2781: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Delftia acidovorans SPH-1

Gene: Daci_1861: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_2750: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Methylibium petroleiphilum PM1

Gene: Mpe_A3710: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3019: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2383: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
fdsC
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3020: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2382: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
fdsD
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2780: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Delftia acidovorans SPH-1

Gene: Daci_1862: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Leptothrix cholodnii SP-6

Gene: Lcho_2749: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_3021: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_2381: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
CRON 2.
fdsR
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1
 
Leptothrix cholodnii SP-6
*
Methylibium petroleiphilum PM1

Site:
position = -28
score = 5.75651
sequence = ATATGCGCTGAAGCGCCGAA

Gene: Mpe_A3707: Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -24
score = 5.75651
sequence = ATATGCTTTGGAAAGCCGAA

Gene: Vapar_3016: Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
Verminephrobacter eiseniae EF01-2
Formate dehydrogenase transcriptional regulator FdsR, ModE family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD