Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE3 - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis 6 2
Ralstonia eutropha H16 6 2
Ralstonia eutropha JMP134 6 2
Ralstonia metallidurans CH34 6 2
Ralstonia pickettii 12J 5 2
Ralstonia solanacearum GMI1000 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tupB
*
Cupriavidus taiwanensis

Site:
position = -31
score = 5.63301
sequence = TTATGTCTGCAAGAACATAA

Gene: RALTA_A1003: Tungstate ABC-type transporter, substrate-binding protein
*
Ralstonia eutropha H16

Site:
position = -37
score = 5.93348
sequence = TTATGTCTGGAAAAACATAA

Gene: H16_A1019: Tungstate ABC-type transporter, substrate-binding protein
*
Ralstonia eutropha JMP134

Site:
position = -35
score = 5.83996
sequence = TTATGTTTATCGAAACATAA

Gene: Reut_A0931: Tungstate ABC-type transporter, substrate-binding protein
*
Ralstonia metallidurans CH34

Site:
position = -35
score = 5.6229
sequence = TTGTGTTTCCAAAAACATAA

Gene: Rmet_0895: Tungstate ABC-type transporter, substrate-binding protein
*
Ralstonia pickettii 12J

Site:
position = -52
score = 5.19904
sequence = TCATGCAGCATCCGACATAA

Gene: Rpic_2244: Tungstate ABC-type transporter, substrate-binding protein
*
Ralstonia solanacearum GMI1000

Site:
position = -50
score = 5.19904
sequence = TCATGCAGCATCCGACATAA

Gene: RS03658: Tungstate ABC-type transporter, substrate-binding protein
Tungstate ABC-type transporter, substrate-binding protein
 
CRON 2.
modE3
*
Cupriavidus taiwanensis

Site:
position = -128
score = 5.63301
sequence = TTATGTTCTTGCAGACATAA

Gene: RALTA_A1004: Molybdate-responsive transcriptional regulator ModE2
*
Ralstonia eutropha H16

Site:
position = -127
score = 5.93348
sequence = TTATGTTTTTCCAGACATAA

Gene: H16_A1020: Molybdate-responsive transcriptional regulator ModE2
*
Ralstonia eutropha JMP134

Site:
position = -128
score = 5.83996
sequence = TTATGTTTCGATAAACATAA

Gene: Reut_A0932: Molybdate-responsive transcriptional regulator ModE2
*
Ralstonia metallidurans CH34

Site:
position = -127
score = 5.6229
sequence = TTATGTTTTTGGAAACACAA

Gene: Rmet_0896: Molybdate-responsive transcriptional regulator ModE2
*
Ralstonia pickettii 12J

Site:
position = -126
score = 5.19904
sequence = TTATGTCGGATGCTGCATGA

Gene: Rpic_2243: Molybdate-responsive transcriptional regulator ModE2
*
Ralstonia solanacearum GMI1000

Site:
position = -109
score = 5.19904
sequence = TTATGTCGGATGCTGCATGA

Gene: RS03657: Molybdate-responsive transcriptional regulator ModE2
Molybdate-responsive transcriptional regulator ModE2
H16_A1021
 
Cupriavidus taiwanensis

Gene: RALTA_A1005: Putative transmembrane protein
 
Ralstonia eutropha H16

Gene: H16_A1021: Putative transmembrane protein
 
Ralstonia eutropha JMP134

Gene: Reut_A0933: Putative transmembrane protein
 
Ralstonia metallidurans CH34

Gene: Rmet_0897: Putative transmembrane protein
 
Ralstonia pickettii 12J

Gene: Rpic_2737: Putative transmembrane protein
 
Ralstonia solanacearum GMI1000

Gene: RS01138: Putative transmembrane protein
Putative transmembrane protein
H16_A1022
 
Cupriavidus taiwanensis

Gene: RALTA_A1006: Putative ABC-type transporter, permease protein
 
Ralstonia eutropha H16

Gene: H16_A1022: Putative ABC-type transporter, permease protein
 
Ralstonia eutropha JMP134

Gene: Reut_A0934: Putative ABC-type transporter, permease protein
 
Ralstonia metallidurans CH34

Gene: Rmet_0898: Putative ABC-type transporter, permease protein
 
Ralstonia pickettii 12J

Gene: Rpic_2242: Putative ABC-type transporter, permease protein
 
Ralstonia solanacearum GMI1000

Gene: RS03656: Putative ABC-type transporter, permease protein
Putative ABC-type transporter, permease protein
H16_A1023
 
Cupriavidus taiwanensis

Gene: RALTA_A1007: Putative heme-binding protein
 
Ralstonia eutropha H16

Gene: H16_A1023: Putative heme-binding protein
 
Ralstonia eutropha JMP134

Gene: Reut_A0935: Putative heme-binding protein
 
Ralstonia metallidurans CH34

Gene: Rmet_0899: Putative heme-binding protein
 
Ralstonia pickettii 12J

Gene: Rpic_2241: Putative heme-binding protein
 
Ralstonia solanacearum GMI1000

Gene: RS03655: Putative heme-binding protein
Putative heme-binding protein
H16_A1024
 
Cupriavidus taiwanensis

Gene: RALTA_A1008: Conserved hypothetical protein, DUF924
 
Ralstonia eutropha H16

Gene: H16_A1024: Conserved hypothetical protein, DUF924
 
Ralstonia eutropha JMP134

Gene: Reut_A0936: Conserved hypothetical protein, DUF924
 
Ralstonia metallidurans CH34

Gene: Rmet_0900: Conserved hypothetical protein, DUF924
 
Ralstonia pickettii 12J

Gene: Rpic_2240: Conserved hypothetical protein, DUF924
 
Ralstonia solanacearum GMI1000

Gene: RS03654: Conserved hypothetical protein, DUF924
Conserved hypothetical protein, DUF924
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD