Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FdsR - Ralstonia

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Phylum: Proteobacteria/Beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cupriavidus taiwanensis 6 2
Ralstonia eutropha H16 6 2
Ralstonia eutropha JMP134 6 2
Ralstonia metallidurans CH34 6 2
Ralstonia pickettii 12J
Ralstonia solanacearum GMI1000
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fdsR
*
Cupriavidus taiwanensis

Site:
position = -104
score = 5.73744
sequence = ATATGCTATTTTTTTCCTAT

Site:
position = -18
score = 5.58753
sequence = ATAAGCTATTTTCTACATAT

Gene: RALTA_A0596: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Ralstonia eutropha H16

Site:
position = -105
score = 5.73744
sequence = ATATGCTATTTTTTTCCTAT

Site:
position = -18
score = 5.58753
sequence = ATAAGCTATTTTCTACATAT

Gene: H16_A0639: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Ralstonia eutropha JMP134

Site:
position = -18
score = 5.49713
sequence = ATAAGCTATTTTGTTCATAT

Site:
position = -105
score = 5.73744
sequence = ATATGCTATTTTTTTCCTAT

Gene: Reut_A0616: Formate dehydrogenase transcriptional regulator FdsR, ModE family
*
Ralstonia metallidurans CH34

Site:
position = 12
score = 5.67824
sequence = ATATGCTATTTTCCGCATAT

Gene: Rmet_0552: Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
Formate dehydrogenase transcriptional regulator FdsR, ModE family
 
CRON 2.
fdsG
*
Cupriavidus taiwanensis

Site:
position = -163
score = 5.58753
sequence = ATATGTAGAAAATAGCTTAT

Site:
position = -77
score = 5.73744
sequence = ATAGGAAAAAAATAGCATAT

Gene: RALTA_A0597: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Ralstonia eutropha H16

Site:
position = -65
score = 5.73744
sequence = ATAGGAAAAAAATAGCATAT

Site:
position = -152
score = 5.58753
sequence = ATATGTAGAAAATAGCTTAT

Gene: H16_A0640: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Ralstonia eutropha JMP134

Site:
position = -149
score = 5.49713
sequence = ATATGAACAAAATAGCTTAT

Site:
position = -62
score = 5.73744
sequence = ATAGGAAAAAAATAGCATAT

Gene: Reut_A0617: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
*
Ralstonia metallidurans CH34

Site:
position = -145
score = 5.67824
sequence = ATATGCGGAAAATAGCATAT

Gene: Rmet_0553: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
fdsB
 
Cupriavidus taiwanensis

Gene: RALTA_A0598: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Ralstonia eutropha H16

Gene: H16_A0641: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Ralstonia eutropha JMP134

Gene: Reut_A0618: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Ralstonia metallidurans CH34

Gene: Rmet_0554: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 2
Ralstonia pickettii 12J

Gene: Rpic_4643: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit

Gene: Rpic_4392: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
 
Ralstonia solanacearum GMI1000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
fdsA
 
Cupriavidus taiwanensis

Gene: RALTA_A0599: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Ralstonia eutropha H16

Gene: H16_A0642: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Ralstonia eutropha JMP134

Gene: Reut_A0619: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Ralstonia metallidurans CH34

Gene: Rmet_0555: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 2
Ralstonia pickettii 12J

Gene: Rpic_4391: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit

Gene: Rpic_4642: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
 
Ralstonia solanacearum GMI1000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
fdsC
 
Cupriavidus taiwanensis

Gene: RALTA_A0600: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Ralstonia eutropha H16

Gene: H16_A0643: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Ralstonia eutropha JMP134

Gene: Reut_A0620: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Ralstonia metallidurans CH34

Gene: Rmet_0556: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
fdsD
 
Cupriavidus taiwanensis

Gene: RALTA_A0601: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Ralstonia eutropha H16

Gene: H16_A0644: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Ralstonia eutropha JMP134

Gene: Reut_A0621: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Ralstonia metallidurans CH34

Gene: Rmet_0557: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
 
Ralstonia pickettii 12J
 
Ralstonia solanacearum GMI1000
NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD