Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Apha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1 4 3
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modE
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -32
score = 5.39117
sequence = TTATGCATTCAGCATATATAT

Gene: RSP_3874: Molybdate-responsive transcriptional regulator ModE
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Molybdate-responsive transcriptional regulator ModE
modD
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1
 
Loktanella vestfoldensis SKA53
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222
*2
Rhodobacter sphaeroides 2.4.1

Site:
position = -135
score = 5.25012
sequence = TTATGTAGTCGAGAAACATAG

Gene: RSP_2501: Molybdenum transport system protein ModD

Gene: RSP_3873: Molybdenum transport system protein ModD
 
Rhodobacterales bacterium HTCC2654
 
Roseobacter sp. MED193
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Sulfitobacter sp. EE-36
Molybdenum transport system protein ModD
 
CRON 2.
modA
 
Hyphomonas neptunium ATCC 15444
 
Jannaschia sp. CCS1

Gene: Jann_2470: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_00974: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Oceanicaulis alexandrii HTCC2633
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06555: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Oceanicola granulosus HTCC2516
 
Paracoccus denitrificans PD1222

Gene: Pden_2665: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Rhodobacter sphaeroides 2.4.1

Site:
position = -78
score = 6.15512
sequence = ATATGTAGTTCGAATACATAA

Gene: RSP_3871: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_14140: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Roseobacter sp. MED193

Gene: MED193_01635: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Roseovarius nubinhibens ISM

Gene: ISM_01355: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Roseovarius sp. 217
 
Silicibacter TM1040

Gene: TM1040_3664: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Silicibacter pomeroyi DSS-3

Gene: SPO0699: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Sulfitobacter sp. EE-36

Gene: EE36_03318: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD