Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Agrobacterium tumefaciens str. C58 (Cereon)
Azorhizobium caulinodans ORS 571
Bartonella quintana str. Toulouse
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Brucella melitensis 16M
Mesorhizobium loti MAFF303099
Mesorhizobium sp. BNC1
Nitrobacter winogradskyi Nb-255
Rhizobium etli CFN 42
Rhizobium leguminosarum bv. viciae 3841
Rhizobium sp. NGR234
Rhodopseudomonas palustris CGA009 10 2
Sinorhizobium meliloti 1021
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
RPA0152
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*
Rhodopseudomonas palustris CGA009

Site:
position = -79
score = 5.19079
sequence = TTGTTTACTCAGATTACATAT

Gene: RPA0152: Hypothetical protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Hypothetical protein
RPA0151
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0151: Putative ABC transporter, substrate-binding protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putative ABC transporter, substrate-binding protein
RPA0150
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0150: Putative ABC transporter, permease protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putative ABC transporter, permease protein
RPA0149
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0149: Putative ABC transporter, ATP-binding protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Putative ABC transporter, ATP-binding protein
modC2
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
 
Rhodopseudomonas palustris CGA009

Gene: RPA0148: ABC-type molybdate transport system, ATP-binding protein
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
ABC-type molybdate transport system, ATP-binding protein
modE
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_1791: Molybdate-responsive transcriptional regulator ModE
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Brucella melitensis 16M
 
Mesorhizobium loti MAFF303099
 
Mesorhizobium sp. BNC1
 
Nitrobacter winogradskyi Nb-255
 
Rhizobium etli CFN 42
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234
*2
Rhodopseudomonas palustris CGA009

Gene: RPA0147: Molybdate-responsive transcriptional regulator ModE

Site:
position = -54
score = 4.45888
sequence = TTATATAGTTCTTGCATATGA

Gene: RPA4718: Molybdate-responsive transcriptional regulator ModE
 
Sinorhizobium meliloti 1021
 
Xanthobacter autotrophicus Py2
Molybdate-responsive transcriptional regulator ModE
modA
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2561: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2368: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr8160: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2080: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Brucella melitensis 16M

Gene: BMEII0005: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Mesorhizobium loti MAFF303099

Gene: mll1465: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_2722: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0340: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH04071: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium sp. NGR234

Gene: NGR_c29840: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA4717: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Sinorhizobium meliloti 1021

Gene: SMc03196: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Xanthobacter autotrophicus Py2
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2562: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2369: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr8161: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2079: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Brucella melitensis 16M

Gene: BMEII0004: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Mesorhizobium loti MAFF303099

Gene: mll1464: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Mesorhizobium sp. BNC1

Gene: Meso_2721: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0339: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Rhizobium etli CFN 42

Gene: RHE_CH04072: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4686: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Rhizobium sp. NGR234

Gene: NGR_c29850: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA4716: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Sinorhizobium meliloti 1021

Gene: SMc03197: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Xanthobacter autotrophicus Py2
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2563: Molybdate ABC transporter, ATP-binding protein
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2370: Molybdate ABC transporter, ATP-binding protein
 
Bartonella quintana str. Toulouse
 
Bradyrhizobium japonicum USDA 110

Gene: blr8162: Molybdate ABC transporter, ATP-binding protein
 
Bradyrhizobium sp. BTAi1

Gene: BBta_2078: Molybdate ABC transporter, ATP-binding protein
 
Brucella melitensis 16M

Gene: BMEII0003: Molybdate ABC transporter, ATP-binding protein
 
Mesorhizobium loti MAFF303099

Gene: mll1463: Molybdate ABC transporter, ATP-binding protein
 
Mesorhizobium sp. BNC1

Gene: Meso_2720: Molybdate ABC transporter, ATP-binding protein
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0338: Molybdate ABC transporter, ATP-binding protein
 
Rhizobium etli CFN 42

Gene: RHE_CH04073: Molybdate ABC transporter, ATP-binding protein
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL4687: Molybdate ABC transporter, ATP-binding protein
 
Rhizobium sp. NGR234

Gene: NGR_c29860: Molybdate ABC transporter, ATP-binding protein
 
Rhodopseudomonas palustris CGA009

Gene: RPA4715: Molybdate ABC transporter, ATP-binding protein
 
Sinorhizobium meliloti 1021

Gene: SMc03198: Molybdate ABC transporter, ATP-binding protein
 
Xanthobacter autotrophicus Py2
Molybdate ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD