Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LldR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: activator (repressor)
Biological process: Lactate utilization
Effector: L-lactate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 3 1
Shewanella putrefaciens CN-32 3 1
Shewanella sp W3-18-1 3 1
Shewanella sp ANA-3 3 1
Shewanella sp MR-4 3 1
Shewanella sp MR-7 3 1
Shewanella baltica OS155 3 1
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400 3 1
Shewanella amazonensis SB2B 3 1
Shewanella loihica PV-4 3 1
Shewanella pealeana ATCC 700345 3 1
Shewanella halifaxensis HAW-EB4 3 1
Shewanella piezotolerans WP3 3 1
Shewanella sediminis HAW-EB3 3 1
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lldE
*
Shewanella oneidensis MR-1

Site:
position = -123
score = 6.24847
sequence = TAAATTAGGGCTACTTATTTA

Gene: SO_1520: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella putrefaciens CN-32

Site:
position = -123
score = 6.23677
sequence = TAAATTAGGACTACTTATTTC

Gene: Sputcn32_1270: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella sp W3-18-1

Site:
position = -123
score = 6.23677
sequence = TAAATTAGGACTACTTATTTC

Gene: Sputw3181_2836: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella sp ANA-3

Site:
position = -91
score = 6.3277
sequence = TAAATTAGCGCTACTTATTTA

Gene: Shewana3_2906: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella sp MR-4

Site:
position = -123
score = 6.3277
sequence = TAAATTAGCGCTACTTATTTA

Gene: Shewmr4_2736: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella sp MR-7

Site:
position = -123
score = 6.3277
sequence = TAAATTAGCGCTACTTATTTA

Gene: Shewmr7_2809: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella baltica OS155

Site:
position = -123
score = 5.68827
sequence = TAAATTAGGGCTACTTATTCC

Gene: Sbal_1352: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -133
score = 5.19693
sequence = TTAATTAGCACTACATTTTAT

Gene: Sfri_1852: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella amazonensis SB2B

Site:
position = -115
score = 4.06734
sequence = TActaAAtTACcACTAtTTTA

Gene: Sama_2441: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella loihica PV-4

Site:
position = -154
score = 6.10506
sequence = TAAATTAGCACTACTTATTAT

Gene: Shew_3004: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella pealeana ATCC 700345

Site:
position = -168
score = 5.81653
sequence = TAAATTAGCACTACTTTTTAC

Gene: Spea_2996: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella halifaxensis HAW-EB4

Site:
position = -168
score = 5.81653
sequence = TAAATTAGCACTACTTTTTAC

Gene: Shal_3085: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella piezotolerans WP3

Site:
position = -154
score = 5.77814
sequence = TAAATTAGCACTACTTTTTAT

Gene: swp_3635: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
*
Shewanella sediminis HAW-EB3

Site:
position = -149
score = 6.10506
sequence = TAAATTAGCACTACTTATTAT

Gene: Ssed_3924: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
 
Shewanella woodyi ATCC 51908
Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
lldF
 
Shewanella oneidensis MR-1

Gene: SO_1519: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1269: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella sp W3-18-1

Gene: Sputw3181_2837: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella sp ANA-3

Gene: Shewana3_2907: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella sp MR-4

Gene: Shewmr4_2737: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella sp MR-7

Gene: Shewmr7_2810: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella baltica OS155

Gene: Sbal_1351: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1853: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella amazonensis SB2B

Gene: Sama_2442: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella loihica PV-4

Gene: Shew_3005: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella pealeana ATCC 700345

Gene: Spea_2997: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3086: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella piezotolerans WP3

Gene: swp_3636: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3923: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
 
Shewanella woodyi ATCC 51908
Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
lldG
 
Shewanella oneidensis MR-1

Gene: SO_1518: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_1268: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella sp W3-18-1

Gene: Sputw3181_2838: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella sp ANA-3

Gene: Shewana3_2908: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella sp MR-4

Gene: Shewmr4_2738: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella sp MR-7

Gene: Shewmr7_2811: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella baltica OS155

Gene: Sbal_1350: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_1854: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella amazonensis SB2B

Gene: Sama_2443: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella loihica PV-4

Gene: Shew_3006: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella pealeana ATCC 700345

Gene: Spea_2998: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3087: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella piezotolerans WP3

Gene: swp_3637: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3922: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
 
Shewanella woodyi ATCC 51908
Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD