Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 93 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 10 5
Shewanella putrefaciens CN-32 11 5
Shewanella sp W3-18-1 11 5
Shewanella sp ANA-3 11 5
Shewanella sp MR-4 11 5
Shewanella sp MR-7 11 5
Shewanella baltica OS155 11 5
Shewanella denitrificans OS217 9 3
Shewanella frigidimarina NCIMB 400 10 4
Shewanella amazonensis SB2B 11 5
Shewanella loihica PV-4 11 5
Shewanella pealeana ATCC 700345 11 5
Shewanella halifaxensis HAW-EB4 11 5
Shewanella piezotolerans WP3 11 5
Shewanella sediminis HAW-EB3 11 5
Shewanella woodyi ATCC 51908 10 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ygbA
*
Shewanella oneidensis MR-1

Site:
position = -29
score = 4.09269
sequence = TTATCCGAGTCACAGACTAAGGTAT

Gene: SO_0324: hypothetical protein involved in nitrosative stress
*
Shewanella putrefaciens CN-32

Site:
position = -29
score = 4.87701
sequence = ATATCCGAGTAACTGACTAAGGTAT

Gene: Sputcn32_3663: hypothetical protein involved in nitrosative stress
*
Shewanella sp W3-18-1

Site:
position = -29
score = 4.87701
sequence = ATATCCGAGTAACTGACTAAGGTAT

Gene: Sputw3181_3804: hypothetical protein involved in nitrosative stress
*
Shewanella sp ANA-3

Site:
position = -29
score = 4.44894
sequence = TTATCCGAGTGACAGACTAAGGTAT

Gene: Shewana3_3845: hypothetical protein involved in nitrosative stress
*
Shewanella sp MR-4

Site:
position = -29
score = 4.44894
sequence = TTATCCGAGTGACAGACTAAGGTAT

Gene: Shewmr4_3649: hypothetical protein involved in nitrosative stress
*
Shewanella sp MR-7

Site:
position = -29
score = 4.44894
sequence = TTATCCGAGTGACAGACTAAGGTAT

Gene: Shewmr7_0295: hypothetical protein involved in nitrosative stress
*
Shewanella baltica OS155

Site:
position = -29
score = 4.52745
sequence = ATATCCGAGTGACAAGCTAAGGTAT

Gene: Sbal_4067: hypothetical protein involved in nitrosative stress
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -43
score = 5.57281
sequence = ATATCCGACTGTTTTACTAAGGTAT

Gene: Sfri_0404: hypothetical protein involved in nitrosative stress
*
Shewanella amazonensis SB2B

Site:
position = -30
score = 5.12049
sequence = AAAACCAAGTAAATTACTTGGGTAT

Gene: Sama_3326: hypothetical protein involved in nitrosative stress
*
Shewanella loihica PV-4

Site:
position = -28
score = 4.83325
sequence = ATAACCCAGTAAAGAAGTCAGATAT

Gene: Shew_0259: hypothetical protein involved in nitrosative stress
*
Shewanella pealeana ATCC 700345

Site:
position = -28
score = 5.02174
sequence = ATAACCAAGTAGCTTACTAAGGTAT

Gene: Spea_0303: hypothetical protein involved in nitrosative stress
*
Shewanella halifaxensis HAW-EB4

Site:
position = -28
score = 5.12765
sequence = ATAACCCAGTAACTTACTAAGGTAT

Gene: Shal_3986: hypothetical protein involved in nitrosative stress
*
Shewanella piezotolerans WP3

Site:
position = -28
score = 4.77666
sequence = ATAACCCAGTGGCTTACTAAGGTAT

Gene: swp_2171: hypothetical protein involved in nitrosative stress
*
Shewanella sediminis HAW-EB3

Site:
position = -125
score = 5.36272
sequence = GTACCTTAGTAATTTACTAGGGTAT

Gene: Ssed_4199: hypothetical protein involved in nitrosative stress
 
Shewanella woodyi ATCC 51908

Gene: Swoo_0395: hypothetical protein involved in nitrosative stress
hypothetical protein involved in nitrosative stress
 
CRON 2.
iscR
*
Shewanella oneidensis MR-1

Site:
position = -90
score = 5.48351
sequence = ATACTTGAGTGATTTACTAGGTTTT

Site:
position = -65
score = 6.36439
sequence = ATACTTGACTGATTTACTCGGGTAT

Gene: SO_2263: Iron-sulfur cluster regulator IscR
*
Shewanella putrefaciens CN-32

Site:
position = -66
score = 6.44897
sequence = ATACTTGACTAATTTACTCGGGTAT

Site:
position = -91
score = 4.30123
sequence = TTACCTGAGTGTTTTAGTAGGACTT

Gene: Sputcn32_2150: Iron-sulfur cluster regulator IscR
*
Shewanella sp W3-18-1

Site:
position = -91
score = 4.30123
sequence = TTACCTGAGTGTTTTAGTAGGACTT

Site:
position = -66
score = 6.44897
sequence = ATACTTGACTAATTTACTCGGGTAT

Gene: Sputw3181_1861: Iron-sulfur cluster regulator IscR
*
Shewanella sp ANA-3

Site:
position = -90
score = 5.38559
sequence = ATACCTGAGTGTTTTACTAGGTTTT

Site:
position = -65
score = 6.273
sequence = ATACTTGACTGAAATACTCGGGTAT

Gene: Shewana3_2281: Iron-sulfur cluster regulator IscR
*
Shewanella sp MR-4

Site:
position = -90
score = 5.59506
sequence = ATACTTGAGTATTTTACTAGGGTTT

Site:
position = -65
score = 6.36439
sequence = ATACTTGACTGAATTACTCGGGTAT

Gene: Shewmr4_1738: Iron-sulfur cluster regulator IscR
*
Shewanella sp MR-7

Site:
position = -90
score = 5.39212
sequence = ATACTTGAGTGTTTTACTAGGTTTT

Site:
position = -65
score = 6.36059
sequence = ATACTTGACTGAAATACTCAGGTAT

Gene: Shewmr7_1818: Iron-sulfur cluster regulator IscR
*
Shewanella baltica OS155

Site:
position = -90
score = 5.41491
sequence = ATACTTGAGTGTTTTAGTAGGTTTT

Site:
position = -64
score = 6.36439
sequence = ATACTTGACTGATTTACTCGGGTAT

Gene: Sbal_2398: Iron-sulfur cluster regulator IscR
*
Shewanella denitrificans OS217

Site:
position = -88
score = 5.14002
sequence = ATACTTGAGTAAAACACTAGGTTTA

Site:
position = -63
score = 6.44897
sequence = ATACTTGACTAAATTACTCGGGTAT

Gene: Sden_1457: Iron-sulfur cluster regulator IscR
*
Shewanella frigidimarina NCIMB 400

Site:
position = -89
score = 4.51876
sequence = ATACCCGAGTGTTTTGGTAGGATTA

Site:
position = -64
score = 6.16346
sequence = ATACTTGACTAAATTACTAGGGTAT

Gene: Sfri_2425: Iron-sulfur cluster regulator IscR
*
Shewanella amazonensis SB2B

Site:
position = -91
score = 5.55689
sequence = ATACTTGAGTAAATTAGTTGGTTTT

Site:
position = -66
score = 6.46941
sequence = ATAGTTGACTAAATTACTCAGGTAT

Gene: Sama_1292: Iron-sulfur cluster regulator IscR
*
Shewanella loihica PV-4

Site:
position = -65
score = 6.38991
sequence = ATACTTGACTAAAACAGTCAAGTAT

Site:
position = -90
score = 5.05782
sequence = ATACCTGACTAATCTGCTAGGTTTT

Gene: Shew_2318: Iron-sulfur cluster regulator IscR
*
Shewanella pealeana ATCC 700345

Site:
position = -65
score = 6.38037
sequence = ATACTTGACTAAAATAGTCGGGTAT

Site:
position = -90
score = 5.03724
sequence = ATACTTGACCGAATTGCTAGGCTTT

Gene: Spea_1487: Iron-sulfur cluster regulator IscR
*
Shewanella halifaxensis HAW-EB4

Site:
position = -90
score = 4.50889
sequence = ATACCTGACCAAATAGCTAGGCTTA

Site:
position = -65
score = 5.95108
sequence = ATACTTGACTGAAACGGTCGGGTAT

Gene: Shal_1571: Iron-sulfur cluster regulator IscR
*
Shewanella piezotolerans WP3

Site:
position = -90
score = 5.1819
sequence = ATACTTGACCAAACCACTAGGTTAA

Site:
position = -65
score = 6.53656
sequence = ATACTTGACTAAATTACTCAGGTAT

Gene: swp_1693: Iron-sulfur cluster regulator IscR
*
Shewanella sediminis HAW-EB3

Site:
position = -161
score = 4.46036
sequence = ATACCCCACCAAAGTGGCAGGGTAT

Site:
position = -63
score = 6.38037
sequence = ATACTTGACTAAAATAGTCGGGTAT

Gene: Ssed_2872: Iron-sulfur cluster regulator IscR
*
Shewanella woodyi ATCC 51908

Site:
position = -215
score = 4.10821
sequence = TTTCGTGAGTATTATGGTAAAGATT

Site:
position = -90
score = 5.07237
sequence = ATACTTGACTAAACTACTAGGTTTA

Site:
position = -65
score = 6.36059
sequence = ATACTTGACTAAAACACTCAGGTAT

Gene: Swoo_1775: Iron-sulfur cluster regulator IscR
Iron-sulfur cluster regulator IscR
iscS
 
Shewanella oneidensis MR-1

Gene: SO_2264: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2149: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella sp W3-18-1

Gene: Sputw3181_1862: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella sp ANA-3

Gene: Shewana3_2280: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella sp MR-4

Gene: Shewmr4_1739: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella sp MR-7

Gene: Shewmr7_1819: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella baltica OS155

Gene: Sbal_2397: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella denitrificans OS217

Gene: Sden_1458: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2424: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella amazonensis SB2B

Gene: Sama_1293: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella loihica PV-4

Gene: Shew_2317: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella pealeana ATCC 700345

Gene: Spea_1488: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1572: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella piezotolerans WP3

Gene: swp_1694: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2871: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1776: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
 
Shewanella oneidensis MR-1

Gene: SO_2265: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2148: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella sp W3-18-1

Gene: Sputw3181_1863: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella sp ANA-3

Gene: Shewana3_2279: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella sp MR-4

Gene: Shewmr4_1740: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella sp MR-7

Gene: Shewmr7_1820: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella baltica OS155

Gene: Sbal_2396: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella denitrificans OS217

Gene: Sden_1459: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2423: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella amazonensis SB2B

Gene: Sama_1294: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella loihica PV-4

Gene: Shew_2316: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella pealeana ATCC 700345

Gene: Spea_1489: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1573: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella piezotolerans WP3

Gene: swp_1695: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2870: Iron-sulfur cluster assembly scaffold protein IscU
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1777: Iron-sulfur cluster assembly scaffold protein IscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
 
Shewanella oneidensis MR-1

Gene: SO_2266: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2147: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella sp W3-18-1

Gene: Sputw3181_1864: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella sp ANA-3

Gene: Shewana3_2278: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella sp MR-4

Gene: Shewmr4_1741: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella sp MR-7

Gene: Shewmr7_1821: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella baltica OS155

Gene: Sbal_2395: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella denitrificans OS217

Gene: Sden_1460: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2422: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella amazonensis SB2B

Gene: Sama_1295: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella loihica PV-4

Gene: Shew_2315: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella pealeana ATCC 700345

Gene: Spea_1490: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1574: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella piezotolerans WP3

Gene: swp_1697: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2869: Iron binding protein IscA for iron-sulfur cluster assembly
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1778: Iron binding protein IscA for iron-sulfur cluster assembly
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
 
Shewanella oneidensis MR-1

Gene: SO_2267: Chaperone protein HscB
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2146: Chaperone protein HscB
 
Shewanella sp W3-18-1

Gene: Sputw3181_1865: Chaperone protein HscB
 
Shewanella sp ANA-3

Gene: Shewana3_2277: Chaperone protein HscB
 
Shewanella sp MR-4

Gene: Shewmr4_1742: Chaperone protein HscB
 
Shewanella sp MR-7

Gene: Shewmr7_1822: Chaperone protein HscB
 
Shewanella baltica OS155

Gene: Sbal_2394: Chaperone protein HscB
 
Shewanella denitrificans OS217

Gene: Sden_1461: Chaperone protein HscB
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2421: Chaperone protein HscB
 
Shewanella amazonensis SB2B

Gene: Sama_1296: Chaperone protein HscB
 
Shewanella loihica PV-4

Gene: Shew_2314: Chaperone protein HscB
 
Shewanella pealeana ATCC 700345

Gene: Spea_1491: Chaperone protein HscB
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1575: Chaperone protein HscB
 
Shewanella piezotolerans WP3

Gene: swp_1698: Chaperone protein HscB
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2868: Chaperone protein HscB
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1779: Chaperone protein HscB
Chaperone protein HscB
hscA
 
Shewanella oneidensis MR-1

Gene: SO_2268: Chaperone protein HscA
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2145: Chaperone protein HscA
 
Shewanella sp W3-18-1

Gene: Sputw3181_1866: Chaperone protein HscA
 
Shewanella sp ANA-3

Gene: Shewana3_2276: Chaperone protein HscA
 
Shewanella sp MR-4

Gene: Shewmr4_1743: Chaperone protein HscA
 
Shewanella sp MR-7

Gene: Shewmr7_1823: Chaperone protein HscA
 
Shewanella baltica OS155

Gene: Sbal_2393: Chaperone protein HscA
 
Shewanella denitrificans OS217

Gene: Sden_1462: Chaperone protein HscA
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2420: Chaperone protein HscA
 
Shewanella amazonensis SB2B

Gene: Sama_1297: Chaperone protein HscA
 
Shewanella loihica PV-4

Gene: Shew_2313: Chaperone protein HscA
 
Shewanella pealeana ATCC 700345

Gene: Spea_1492: Chaperone protein HscA
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1576: Chaperone protein HscA
 
Shewanella piezotolerans WP3

Gene: swp_1699: Chaperone protein HscA
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2867: Chaperone protein HscA
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1780: Chaperone protein HscA
Chaperone protein HscA
fdx
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2144: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella sp W3-18-1

Gene: Sputw3181_1867: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella sp ANA-3

Gene: Shewana3_2275: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella sp MR-4

Gene: Shewmr4_1744: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella sp MR-7

Gene: Shewmr7_1824: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella baltica OS155

Gene: Sbal_2392: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella denitrificans OS217

Gene: Sden_1463: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_2419: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella amazonensis SB2B

Gene: Sama_1298: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella loihica PV-4

Gene: Shew_2312: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella pealeana ATCC 700345

Gene: Spea_1493: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_1577: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella piezotolerans WP3

Gene: swp_1700: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella sediminis HAW-EB3

Gene: Ssed_2866: ferredoxin, 2Fe-2S type, ISC system
 
Shewanella woodyi ATCC 51908

Gene: Swoo_1781: ferredoxin, 2Fe-2S type, ISC system
ferredoxin, 2Fe-2S type, ISC system
 
CRON 3.
nfuA
*
Shewanella oneidensis MR-1

Site:
position = -46
score = 4.95215
sequence = AATTCTTACTAAAACACTCAGGTAT

Gene: SO_4619: NfuA Fe-S protein maturation
*
Shewanella putrefaciens CN-32

Site:
position = -46
score = 4.95215
sequence = AATTCTTACTAAAACACTCAGGTAT

Gene: Sputcn32_3794: NfuA Fe-S protein maturation
*
Shewanella sp W3-18-1

Site:
position = -46
score = 4.95215
sequence = AATTCTTACTAAAACACTCAGGTAT

Gene: Sputw3181_0119: NfuA Fe-S protein maturation
*
Shewanella sp ANA-3

Site:
position = -46
score = 4.95215
sequence = AATTCTTACTAAAACACTCAGGTAT

Gene: Shewana3_4003: NfuA Fe-S protein maturation
*
Shewanella sp MR-4

Site:
position = -46
score = 4.95215
sequence = AATTCTTACTAAAACACTCAGGTAT

Gene: Shewmr4_3804: NfuA Fe-S protein maturation
*
Shewanella sp MR-7

Site:
position = -46
score = 4.95215
sequence = AATTCTTACTAAAACACTCAGGTAT

Gene: Shewmr7_3880: NfuA Fe-S protein maturation
*
Shewanella baltica OS155

Site:
position = -46
score = 4.95215
sequence = AATTCTTACTAAAACACTCAGGTAT

Gene: Sbal_0142: NfuA Fe-S protein maturation
*
Shewanella denitrificans OS217

Site:
position = -46
score = 5.35046
sequence = GTATCTTACTAAATTACTCAGGTAT

Gene: Sden_3528: NfuA Fe-S protein maturation
*
Shewanella frigidimarina NCIMB 400

Site:
position = -46
score = 5.12812
sequence = AATTCTTACTAATTTACTCAGGTAT

Gene: Sfri_0244: NfuA Fe-S protein maturation
*
Shewanella amazonensis SB2B

Site:
position = -44
score = 4.6511
sequence = AATTCTTAGTAATTTACTCAGGTTT

Gene: Sama_3502: NfuA Fe-S protein maturation
*
Shewanella loihica PV-4

Site:
position = -46
score = 4.50171
sequence = AATTCTTACTAAATCACTCGGGTTT

Gene: Shew_0106: NfuA Fe-S protein maturation
*
Shewanella pealeana ATCC 700345

Site:
position = -47
score = 4.49791
sequence = AATTCTTACTAAAACACTCAGGTTT

Gene: Spea_4010: NfuA Fe-S protein maturation
*
Shewanella halifaxensis HAW-EB4

Site:
position = -47
score = 4.49791
sequence = AATTCTTACTAAAACACTCAGGTTT

Gene: Shal_0247: NfuA Fe-S protein maturation
*
Shewanella piezotolerans WP3

Site:
position = -48
score = 4.49791
sequence = AATTCTTACTAAAACACTCAGGTTT

Gene: swp_4841: NfuA Fe-S protein maturation
*
Shewanella sediminis HAW-EB3

Site:
position = -47
score = 4.27558
sequence = AATCCATACTAAAACACTCAAGCAT

Gene: Ssed_0179: NfuA Fe-S protein maturation
*
Shewanella woodyi ATCC 51908

Site:
position = -46
score = 4.38659
sequence = AATCCATACTAAAACACTCAAGTTT

Gene: Swoo_0159: NfuA Fe-S protein maturation
NfuA Fe-S protein maturation
 
CRON 4.
dnrN
*
Shewanella oneidensis MR-1

Site:
position = -167
score = 5.05799
sequence = AATCTTGACTATTTTAGTCAAGATT

Gene: SO_4302: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella putrefaciens CN-32

Site:
position = -90
score = 5.55822
sequence = ATTCCTGAGTGTTTTAGTCGGGTTT

Gene: Sputcn32_3576: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp W3-18-1

Site:
position = -90
score = 5.55822
sequence = ATTCCTGAGTGTTTTAGTCGGGTTT

Gene: Sputw3181_3715: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp ANA-3

Site:
position = -90
score = 5.19173
sequence = ATGCCCGACTAATTTAGTCAGGATT

Gene: Shewana3_0397: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp MR-4

Site:
position = -90
score = 5.19173
sequence = ATGCCCGACTAATTTAGTCAGGATT

Gene: Shewmr4_0398: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sp MR-7

Site:
position = -90
score = 5.19173
sequence = ATGCCCGACTAATTTAGTCAGGATT

Gene: Shewmr7_3627: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella baltica OS155

Site:
position = -89
score = 5.18857
sequence = AATCCTGAGTATTTTAGTCGGGTTT

Gene: Sbal_3989: Nitric oxide-dependent regulator DnrN or NorA
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0450: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella amazonensis SB2B

Site:
position = -87
score = 4.77
sequence = TTAACCCAGCAAAATACTCAAGTTT

Gene: Sama_3236: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella loihica PV-4

Site:
position = -99
score = 5.08773
sequence = AATCCCGAGTAAAACACTCAAGTTT

Gene: Shew_0328: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella pealeana ATCC 700345

Site:
position = -102
score = 5.79984
sequence = TTAACTGAGTATTTTACTCAAGTAA

Gene: Spea_0383: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella halifaxensis HAW-EB4

Site:
position = -104
score = 5.65806
sequence = TTACTTGAGCATTTTACTCAGGTAA

Gene: Shal_3908: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella piezotolerans WP3

Site:
position = -88
score = 5.50332
sequence = TTACCCGAGCATTTTACTCAACTAA

Gene: swp_0412: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella sediminis HAW-EB3

Site:
position = -98
score = 5.56819
sequence = ATTCCTGAGCAATTTAGTCAAGTTT

Gene: Ssed_4124: Nitric oxide-dependent regulator DnrN or NorA
*
Shewanella woodyi ATCC 51908

Site:
position = -97
score = 5.38724
sequence = TTACCCTAGTGTTTTAGTCGGGAAT

Gene: Swoo_0492: Nitric oxide-dependent regulator DnrN or NorA
Nitric oxide-dependent regulator DnrN or NorA
 
CRON 5.
erpA
*
Shewanella oneidensis MR-1

Site:
position = -88
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: SO_1304: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella putrefaciens CN-32

Site:
position = -64
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Sputcn32_1123: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella sp W3-18-1

Site:
position = -64
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Sputw3181_3041: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella sp ANA-3

Site:
position = -64
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Shewana3_3067: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella sp MR-4

Site:
position = -64
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Shewmr4_2889: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella sp MR-7

Site:
position = -64
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Shewmr7_2971: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella baltica OS155

Site:
position = -64
score = 5.67869
sequence = ATACTTGAACAAAACAGTCAGGTAA

Gene: Sbal_1163: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella denitrificans OS217

Site:
position = -62
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Sden_2815: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -63
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Sfri_2976: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella amazonensis SB2B

Site:
position = -64
score = 5.76328
sequence = ATACTTGAACAAAATAGTCAGGTAA

Gene: Sama_0843: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella loihica PV-4

Site:
position = -64
score = 5.76328
sequence = TTACTTGAACAAAATAGTCAGGTAT

Gene: Shew_1017: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella pealeana ATCC 700345

Site:
position = -64
score = 5.65591
sequence = TTACTTGAACAAAACACTCAGGTAT

Gene: Spea_0985: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -64
score = 5.65591
sequence = TTACTTGAACAAAACACTCAGGTAT

Gene: Shal_1036: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella piezotolerans WP3

Site:
position = -64
score = 5.41857
sequence = TTACTTGAACAAAACGGTCAGGTAT

Gene: swp_3849: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella sediminis HAW-EB3

Site:
position = -64
score = 5.50316
sequence = TTACTTGAACAAAATGGTCAGGTAT

Gene: Ssed_1095: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
*
Shewanella woodyi ATCC 51908

Site:
position = -64
score = 5.75526
sequence = ATACTTGAACAAAATGGTCAGGTAT

Gene: Swoo_1203: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD