Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HutC - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 63 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 4 2
Shewanella putrefaciens CN-32 4 2
Shewanella sp W3-18-1 4 2
Shewanella sp ANA-3 4 2
Shewanella sp MR-4 4 2
Shewanella sp MR-7 4 2
Shewanella baltica OS155 4 2
Shewanella denitrificans OS217 4 2
Shewanella frigidimarina NCIMB 400 4 2
Shewanella amazonensis SB2B 2 2
Shewanella loihica PV-4 4 2
Shewanella pealeana ATCC 700345 4 2
Shewanella halifaxensis HAW-EB4 4 2
Shewanella piezotolerans WP3 4 2
Shewanella sediminis HAW-EB3 4 2
Shewanella woodyi ATCC 51908 4 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hutC
*
Shewanella oneidensis MR-1

Site:
position = -131
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Site:
position = -141
score = 5.61431
sequence = TAGCTTGTATTTACTTGTAT

Gene: SO0096: Histidine utilization repressor, GntR family
*
Shewanella putrefaciens CN-32

Site:
position = -168
score = 5.48242
sequence = TGGCTTGTATTTACTTGTAT

Site:
position = -158
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Sputcn32_0078: Histidine utilization repressor, GntR family
*
Shewanella sp W3-18-1

Site:
position = -168
score = 5.48242
sequence = TGGCTTGTATTTACTTGTAT

Site:
position = -158
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Sputw3181_3999: Histidine utilization repressor, GntR family
*
Shewanella sp ANA-3

Site:
position = -122
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Site:
position = -132
score = 5.61431
sequence = TAGCTTGTATTTACTTGTAT

Gene: Shewana3_0099: Histidine utilization repressor, GntR family
*
Shewanella sp MR-4

Site:
position = -132
score = 5.40804
sequence = CAGCTTGTATTTACTTGTAT

Site:
position = -122
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Shewmr4_0098: Histidine utilization repressor, GntR family
*
Shewanella sp MR-7

Site:
position = -132
score = 5.61431
sequence = TAGCTTGTATTTACTTGTAT

Site:
position = -122
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Shewmr7_0093: Histidine utilization repressor, GntR family
*
Shewanella baltica OS155

Site:
position = -167
score = 5.61431
sequence = TAGCTTGTATTTACTTGTAT

Site:
position = -157
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Sbal_4253: Histidine utilization repressor, GntR family
*
Shewanella denitrificans OS217

Site:
position = -86
score = 5.65261
sequence = TGGCTTGTATATACAAGGTA

Gene: Sden_0082: Histidine utilization repressor, GntR family
*
Shewanella frigidimarina NCIMB 400

Site:
position = -57
score = 4.63227
sequence = ATACTTGTTTTAACTTGTAT

Site:
position = -47
score = 5.80362
sequence = TAACTTGTATATACAAGGTA

Gene: Sfri_3954: Histidine utilization repressor, GntR family
*
Shewanella amazonensis SB2B

Site:
position = -89
score = 6.15442
sequence = CTACTTGTATATACAAGTTT

Site:
position = -99
score = 3.97379
sequence = CAGCCAGTATCTACTTGTAT

Gene: Sama_0081: Histidine utilization repressor, GntR family
*
Shewanella loihica PV-4

Site:
position = -128
score = 5.61431
sequence = TAGCTTGTATTTACTTGTAT

Site:
position = -118
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Shew_3758: Histidine utilization repressor, GntR family
*
Shewanella pealeana ATCC 700345

Site:
position = -96
score = 5.27369
sequence = TAGCTTGTGTTTACTTGTAT

Site:
position = -86
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Spea_4170: Histidine utilization repressor, GntR family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -96
score = 5.03414
sequence = CCGCTTGTATTTACTTGTAT

Site:
position = -86
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Shal_0072: Histidine utilization repressor, GntR family
*
Shewanella piezotolerans WP3

Site:
position = -167
score = 5.61431
sequence = TAGCTTGTATTTACTTGTAT

Site:
position = -157
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: swp_0132: Histidine utilization repressor, GntR family
*
Shewanella sediminis HAW-EB3

Site:
position = -140
score = 5.42716
sequence = CAACTTGTATTTACTTGTAT

Site:
position = -130
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Ssed_4448: Histidine utilization repressor, GntR family
*
Shewanella woodyi ATCC 51908

Site:
position = -191
score = 5.42716
sequence = CAACTTGTATTTACTTGTAT

Site:
position = -181
score = 6.09562
sequence = TTACTTGTATATACAAGCTA

Gene: Swoo_4839: Histidine utilization repressor, GntR family
Histidine utilization repressor, GntR family
hutU
 
Shewanella oneidensis MR-1

Gene: SO0097: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0079: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3998: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp ANA-3

Gene: Shewana3_0100: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp MR-4

Gene: Shewmr4_0099: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella sp MR-7

Gene: Shewmr7_0094: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella baltica OS155

Gene: Sbal_4252: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella denitrificans OS217

Gene: Sden_0083: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3953: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella amazonensis SB2B

Gene: Sama_1632: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella loihica PV-4

Gene: Shew_3757: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4169: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0073: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella piezotolerans WP3

Gene: swp_0133: Urocanate hydratase (EC 4.2.1.49)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4447: Urocanate hydratase (EC 4.2.1.49)
*
Shewanella woodyi ATCC 51908

Site:
position = -110
score = 5.43359
sequence = AGTGTTGTATATACAAGTAG

Gene: Swoo_4838: Urocanate hydratase (EC 4.2.1.49)
Urocanate hydratase (EC 4.2.1.49)
hutH
 
Shewanella oneidensis MR-1

Gene: SO0098: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0080: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp W3-18-1

Gene: Sputw3181_3997: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp ANA-3

Gene: Shewana3_0101: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp MR-4

Gene: Shewmr4_0100: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sp MR-7

Gene: Shewmr7_0095: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella baltica OS155

Gene: Sbal_4251: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella denitrificans OS217

Gene: Sden_0084: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_3952: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella amazonensis SB2B

Gene: Sama_1631: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella loihica PV-4

Gene: Shew_3756: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella pealeana ATCC 700345

Gene: Spea_4168: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_0074: Histidine ammonia-lyase (EC 4.3.1.3)
 2
Shewanella piezotolerans WP3

Gene: swp_0134: Histidine ammonia-lyase (EC 4.3.1.3)

Gene: swp_0136: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella sediminis HAW-EB3

Gene: Ssed_4446: Histidine ammonia-lyase (EC 4.3.1.3)
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4837: Histidine ammonia-lyase (EC 4.3.1.3)
Histidine ammonia-lyase (EC 4.3.1.3)
 
CRON 2.
hutI
*
Shewanella oneidensis MR-1

Site:
position = -95
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Site:
position = -85
score = 4.51957
sequence = ATACAAGTAAATACAAGCTA

Gene: SO0095: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella putrefaciens CN-32

Site:
position = -86
score = 4.4374
sequence = ATACAAGTAAATACAAGCCA

Site:
position = -96
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Sputcn32_0077: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella sp W3-18-1

Site:
position = -86
score = 4.4374
sequence = ATACAAGTAAATACAAGCCA

Site:
position = -96
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Sputw3181_4000: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella sp ANA-3

Site:
position = -85
score = 4.51957
sequence = ATACAAGTAAATACAAGCTA

Site:
position = -95
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Shewana3_0098: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella sp MR-4

Site:
position = -85
score = 4.29418
sequence = ATACAAGTAAATACAAGCTG

Site:
position = -95
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Shewmr4_0097: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella sp MR-7

Site:
position = -95
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Site:
position = -85
score = 4.51957
sequence = ATACAAGTAAATACAAGCTA

Gene: Shewmr7_0092: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella baltica OS155

Site:
position = -96
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Site:
position = -86
score = 4.51957
sequence = ATACAAGTAAATACAAGCTA

Gene: Sbal_4254: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella denitrificans OS217

Site:
position = -90
score = 5.55177
sequence = TACCTTGTATATACAAGCCA

Gene: Sden_0081: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -70
score = 5.89901
sequence = TACCTTGTATATACAAGTTA

Site:
position = -60
score = 3.9412
sequence = ATACAAGTTAAAACAAGTAT

Gene: Sfri_3955: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella amazonensis SB2B

Site:
position = -135
score = 3.39077
sequence = ATACAAGTAGATACTGGCTG

Site:
position = -145
score = 6.33127
sequence = AAACTTGTATATACAAGTAG

Gene: Sama_0080: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella loihica PV-4

Site:
position = -85
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Site:
position = -75
score = 4.51957
sequence = ATACAAGTAAATACAAGCTA

Gene: Shew_3759: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella pealeana ATCC 700345

Site:
position = -87
score = 3.92779
sequence = ATACAAGTAAACACAAGCTA

Site:
position = -97
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Spea_4171: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -99
score = 4.05217
sequence = ATACAAGTAAATACAAGCGG

Site:
position = -109
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Shal_0071: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella piezotolerans WP3

Site:
position = -98
score = 4.51957
sequence = ATACAAGTAAATACAAGCTA

Site:
position = -108
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: swp_0131: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella sediminis HAW-EB3

Site:
position = -75
score = 4.55925
sequence = ATACAAGTAAATACAAGTTG

Site:
position = -85
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Ssed_4449: Imidazolonepropionase (EC 3.5.2.7)
*
Shewanella woodyi ATCC 51908

Site:
position = -85
score = 4.55925
sequence = ATACAAGTAAATACAAGTTG

Site:
position = -95
score = 6.51842
sequence = TAGCTTGTATATACAAGTAA

Gene: Swoo_4840: Imidazolonepropionase (EC 3.5.2.7)
Imidazolonepropionase (EC 3.5.2.7)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD