Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acetobacter pasteurianus IFO 3283-01
Azospirillum sp. B510
Gluconacetobacter diazotrophicus PAl 5
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Magnetospirillum magneticum AMB-1 5 3
Magnetospirillum magnetotacticum MS-1 5 3
Rhodospirillum centenum SW
Rhodospirillum rubrum ATCC 11170
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
*
Magnetospirillum magneticum AMB-1

Site:
position = -47
score = 7.03019
sequence = TCGCTATATACATGAACTACATTTCGA

Gene: amb2951: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -198
score = 5.80963
sequence = CCGCTATATTGTCGAGATAAATACCGA

Site:
position = -48
score = 6.72517
sequence = TCGCTATATACCTTAACTACATTTCGT

Gene: Magn03010295: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modQ1
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03010294: Predicted molybdenum delivery protein
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Predicted molybdenum delivery protein
modD
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1

Gene: amb2953: Molybdenum transport system protein ModD
 
Magnetospirillum magnetotacticum MS-1

Gene: Magn03010293: Molybdenum transport system protein ModD
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Molybdenum transport system protein ModD
modQ2
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
 
Magnetospirillum magneticum AMB-1

Gene: amb2952: Predicted molybdenum delivery protein
 
Magnetospirillum magnetotacticum MS-1
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Predicted molybdenum delivery protein
 
CRON 2.
modE
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
*
Magnetospirillum magneticum AMB-1

Site:
position = -39
score = 5.53171
sequence = TCGTCATATAGTGCGCATACATGACGA

Gene: amb2949: Molybdate-responsive transcriptional regulator ModE
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -10
score = 6.27149
sequence = TCGTAATATAGTGTGGCTACATGACGA

Gene: Magn03009350: Molybdate-responsive transcriptional regulator ModE
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Molybdate-responsive transcriptional regulator ModE
 
CRON 3.
modX
 
Acetobacter pasteurianus IFO 3283-01
 
Azospirillum sp. B510
 
Gluconacetobacter diazotrophicus PAl 5
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
*
Magnetospirillum magneticum AMB-1

Site:
position = -289
score = 7.03019
sequence = TCGAAATGTAGTTCATGTATATAGCGA

Gene: amb2950: Predicted molibdenum binding protein
*
Magnetospirillum magnetotacticum MS-1

Site:
position = -198
score = 5.80963
sequence = TCGGTATTTATCTCGACAATATAGCGG

Gene: Magn03010296: Predicted molibdenum binding protein
 
Rhodospirillum centenum SW
 
Rhodospirillum rubrum ATCC 11170
Predicted molibdenum binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD