Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Flavobacteria

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Bacteroidetes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Blattabacterium sp. (Blattella germanica) str. Bge
Candidatus Sulcia muelleri SMDSEM
Capnocytophaga ochracea DSM 7271
Cellulophaga sp. MED134
Croceibacter atlanticus HTCC2559
Flavobacteria bacterium BAL38
Flavobacteria bacterium BBFL7
Flavobacteriaceae bacterium 3519-10
Flavobacteriales bacterium ALC-1
Flavobacteriales bacterium HTCC2170
Flavobacterium johnsoniae UW101 2 1
Flavobacterium psychrophilum JIP02/86
Gramella forsetii KT0803
Kordia algicida OT-1 1 1
Leeuwenhoekiella blandensis MED217
Polaribacter irgensii 23-P
Psychroflexus torquis ATCC 700755
Robiginitalea biformata HTCC2501
Tenacibaculum sp. MED152
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
prs
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170
*
Flavobacterium johnsoniae UW101

Site:
position = -31
score = 6.98589
sequence = TTTGCGTATAATTAACGCAAA

Site:
position = -83
score = 6.70717
sequence = TTTGCGTAATTTTTACACAAA

Gene: Fjoh_0755: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803
*
Kordia algicida OT-1

Site:
position = -22
score = 5.86314
sequence = TTTGCGTACAAATAACGCTAA

Gene: KAOT1_16118: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
 
Leeuwenhoekiella blandensis MED217
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
Fjoh_0754
 
Blattabacterium sp. (Blattella germanica) str. Bge
 
Candidatus Sulcia muelleri SMDSEM
 
Capnocytophaga ochracea DSM 7271
 
Cellulophaga sp. MED134
 
Croceibacter atlanticus HTCC2559
 
Flavobacteria bacterium BAL38
 
Flavobacteria bacterium BBFL7
 
Flavobacteriaceae bacterium 3519-10
 
Flavobacteriales bacterium ALC-1
 
Flavobacteriales bacterium HTCC2170
 
Flavobacterium johnsoniae UW101

Gene: Fjoh_0754: hypothetical protein
 
Flavobacterium psychrophilum JIP02/86
 
Gramella forsetii KT0803
 
Kordia algicida OT-1
 
Leeuwenhoekiella blandensis MED217
 
Polaribacter irgensii 23-P
 
Psychroflexus torquis ATCC 700755
 
Robiginitalea biformata HTCC2501
 
Tenacibaculum sp. MED152
hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD