Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 7 4
Streptomyces coelicolor A3(2) 4 2
Streptomyces griseus subsp. griseus NBRC 13350 8 4
Streptomyces scabiei 87.22 7 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pnuC
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -11
score = 6.39082
sequence = TTATAGTCAGAGTGACTATTA

Gene: SGR_5730: Ribosyl nicotinamide transporter, PnuC family
 
Streptomyces scabiei 87.22
Ribosyl nicotinamide transporter, PnuC family
nadR
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5731: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
 
Streptomyces scabiei 87.22
Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
nrtR1
*
Streptomyces avermitilis MA-4680

Site:
position = -68
score = 5.36972
sequence = TATTGGTCGAAGTGACTATTA

Site:
position = -84
score = 5.42118
sequence = TTATAGTCGAGATGACTATTG

Gene: SAV_6513: Nudix-related transcriptional regulator NrtR
*
Streptomyces coelicolor A3(2)

Site:
position = -36
score = 6.38492
sequence = TTATAGTCGCAGTGACTATTA

Gene: SCO1767: Nudix-related transcriptional regulator NrtR
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5732: Nudix-related transcriptional regulator NrtR
*
Streptomyces scabiei 87.22

Site:
position = -52
score = 6.16106
sequence = TTATAGTCGTTCTGACTATTA

Site:
position = -36
score = 5.45634
sequence = TATTAGTCATGGTGACCATAA

Gene: SCAB_71891: Nudix-related transcriptional regulator NrtR
Nudix-related transcriptional regulator NrtR
draG
 
Streptomyces avermitilis MA-4680

Gene: SAV_6514: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
 
Streptomyces coelicolor A3(2)

Gene: SCO1766: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_5733: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
 
Streptomyces scabiei 87.22

Gene: SCAB_71901: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
NrtR-regulated ADP-ribosyl-glycohydrolase DraG
PF10127
 
Streptomyces avermitilis MA-4680

Gene: SAV_6515: Nucleotidyltransferase, predicted
 
Streptomyces coelicolor A3(2)

Gene: SCO1765: Nucleotidyltransferase, predicted
 
Streptomyces griseus subsp. griseus NBRC 13350
 
Streptomyces scabiei 87.22

Gene: SCAB_71911: Nucleotidyltransferase, predicted
Nucleotidyltransferase, predicted
 
CRON 2.
orfX
*
Streptomyces avermitilis MA-4680

Site:
position = -42
score = 5.62632
sequence = TTATCGTCGTAGTGACGAAAA

Site:
position = -76
score = 4.47399
sequence = ATTTCGTCCCCTTGACGATAA

Gene: SAV_2321: NrtR-regulated hypothetical OrfX
 
Streptomyces coelicolor A3(2)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -37
score = 4.84118
sequence = TTATCGTCGCCATGACGAAAT

Site:
position = -70
score = 5.9879
sequence = TAATAGTCACCTTGACTCTAA

Gene: SGR_831: NrtR-regulated hypothetical OrfX
*
Streptomyces scabiei 87.22

Site:
position = -59
score = 5.52546
sequence = TTATCGTCTGAGTGACACTAA

Site:
position = -92
score = 4.65511
sequence = ATCTCGTCCCCTTGACGATAA

Gene: SCAB_23161: NrtR-regulated hypothetical OrfX
NrtR-regulated hypothetical OrfX
orfY
 
Streptomyces avermitilis MA-4680

Gene: SAV_2322: NrtR-regulated hypothetical OrfY
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_832: NrtR-regulated hypothetical OrfY
 
Streptomyces scabiei 87.22

Gene: SCAB_23171: NrtR-regulated hypothetical OrfY
NrtR-regulated hypothetical OrfY
 
CRON 3.
nrtR2
*
Streptomyces avermitilis MA-4680

Site:
position = -31
score = 4.92496
sequence = TTATCGTCAGGCAGACGACTA

Gene: SAV_2447: Nudix-related transcriptional regulator NrtR
 
Streptomyces coelicolor A3(2)

Gene: SCO5817: Nudix-related transcriptional regulator NrtR
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -31
score = 4.92496
sequence = TTATCGTCAGGCAGACGACTA

Gene: SGR_1704: Nudix-related transcriptional regulator NrtR
*
Streptomyces scabiei 87.22

Site:
position = -31
score = 4.92496
sequence = TTATCGTCAGGCAGACGACTA

Gene: SCAB_24481: Nudix-related transcriptional regulator NrtR
Nudix-related transcriptional regulator NrtR
 
CRON 4.
nadE
*
Streptomyces avermitilis MA-4680

Site:
position = -31
score = 4.58235
sequence = ATCGTGTCGCTTTGACGATTA

Gene: SAV_5948: NAD synthetase (EC 6.3.1.5)
*
Streptomyces coelicolor A3(2)

Site:
position = 41
score = 4.43904
sequence = ATTGCGTCGTTCTGACGATTA

Gene: SCO2238: NAD synthetase (EC 6.3.1.5)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -32
score = 4.38883
sequence = ATCGCGTCAGAAAGACGATTA

Gene: SGR_5258: NAD synthetase (EC 6.3.1.5)
*
Streptomyces scabiei 87.22

Site:
position = -31
score = 5.0177
sequence = ATAATGTCGCTCTGACGATTA

Gene: SCAB_66451: NAD synthetase (EC 6.3.1.5)
NAD synthetase (EC 6.3.1.5)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD