Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Micrococcineae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 13 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Arthrobacter aurescens TC1 8 3
Arthrobacter chlorophenolicus A6 5 1
Arthrobacter sp. FB24 5 1
Beutenbergia cavernae DSM 12333 5 1
Brachybacterium faecium DSM 4810 5 1
Brevibacterium linens BL2
Clavibacter michiganensis subsp. michiganensis NCPPB 382
Janibacter sp. HTCC2649
Jonesia denitrificans DSM 20603
Kocuria rhizophila DC2201 4 1
Kytococcus sedentarius DSM 20547
Leifsonia xyli subsp. xyli str. CTCB07
Renibacterium salmoninarum ATCC 33209 4 1
Tropheryma whipplei str. Twist
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtR
*
Arthrobacter aurescens TC1

Site:
position = -59
score = 5.70161
sequence = TTCTAGTCAACATGACTTTAA

Gene: AAur_2535: Nudix-related transcriptional regulator NrtR
*
Arthrobacter chlorophenolicus A6

Site:
position = -78
score = 5.50566
sequence = TTTGAGTCAAGTTGACTATAA

Gene: Achl_2298: Nudix-related transcriptional regulator NrtR
*
Arthrobacter sp. FB24

Site:
position = -101
score = 5.91768
sequence = TTCTAGTCATGTTGACTATAA

Gene: Arth_2561: Nudix-related transcriptional regulator NrtR
*
Beutenbergia cavernae DSM 12333

Site:
position = -42
score = 4.28407
sequence = ATAAGGTCACGTTCACCTTTA

Site:
position = -71
score = 4.82156
sequence = TTAGGGTTGAGTCGACTCTAA

Gene: Bcav_2777: Nudix-related transcriptional regulator NrtR
*
Brachybacterium faecium DSM 4810

Site:
position = -72
score = 4.73563
sequence = TTCTGGTCACCGTGAGACTAA

Site:
position = -36
score = 5.55328
sequence = TAAAGGTCAACGCGACTTTAA

Gene: Bfae_03740: Nudix-related transcriptional regulator NrtR
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
*
Kocuria rhizophila DC2201

Site:
position = -80
score = 5.69996
sequence = TTAGTGTCACAGTGACTTTTA

Gene: KRH_00470: Nudix-related transcriptional regulator NrtR
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
*
Renibacterium salmoninarum ATCC 33209

Site:
position = -11
score = 6.29416
sequence = TTAAAGTCAAAATGACTATAA

Gene: RSal33209_1516: Nudix-related transcriptional regulator NrtR
 
Tropheryma whipplei str. Twist
Nudix-related transcriptional regulator NrtR
nadA
 
Arthrobacter aurescens TC1

Gene: AAur_2534: Quinolinate synthetase (EC 4.1.99.-)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2297: Quinolinate synthetase (EC 4.1.99.-)
 
Arthrobacter sp. FB24

Gene: Arth_2560: Quinolinate synthetase (EC 4.1.99.-)
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2776: Quinolinate synthetase (EC 4.1.99.-)
 
Brachybacterium faecium DSM 4810

Gene: Bfae_03750: Quinolinate synthetase (EC 4.1.99.-)
 
Brevibacterium linens BL2

Gene: BlinB01003364: Quinolinate synthetase (EC 4.1.99.-)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_01375: Quinolinate synthetase (EC 4.1.99.-)
 
Jonesia denitrificans DSM 20603

Gene: Jden_1458: Quinolinate synthetase (EC 4.1.99.-)
 
Kocuria rhizophila DC2201

Gene: KRH_00460: Quinolinate synthetase (EC 4.1.99.-)
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_23170: Quinolinate synthetase (EC 4.1.99.-)
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx16490: Quinolinate synthetase (EC 4.1.99.-)
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1517: Quinolinate synthetase (EC 4.1.99.-)
 
Tropheryma whipplei str. Twist
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Arthrobacter aurescens TC1

Gene: AAur_2533: L-aspartate oxidase (EC 1.4.3.16)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2296: L-aspartate oxidase (EC 1.4.3.16)
 
Arthrobacter sp. FB24

Gene: Arth_2559: L-aspartate oxidase (EC 1.4.3.16)
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2775: L-aspartate oxidase (EC 1.4.3.16)
 
Brachybacterium faecium DSM 4810

Gene: Bfae_03760: L-aspartate oxidase (EC 1.4.3.16)
 
Brevibacterium linens BL2

Gene: BlinB01003365: L-aspartate oxidase (EC 1.4.3.16)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_09399: L-aspartate oxidase (EC 1.4.3.16)
 
Jonesia denitrificans DSM 20603

Gene: Jden_2094: L-aspartate oxidase (EC 1.4.3.16)
 
Kocuria rhizophila DC2201

Gene: KRH_00450: L-aspartate oxidase (EC 1.4.3.16)
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_23160: L-aspartate oxidase (EC 1.4.3.16)
 
Leifsonia xyli subsp. xyli str. CTCB07
 2
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1518: L-aspartate oxidase (EC 1.4.3.16)

Gene: RSal33209_1519: L-aspartate oxidase (EC 1.4.3.16)
 
Tropheryma whipplei str. Twist
L-aspartate oxidase (EC 1.4.3.16)
nadC
 
Arthrobacter aurescens TC1

Gene: AAur_2532: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2295: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Arthrobacter sp. FB24

Gene: Arth_2558: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2774: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Brachybacterium faecium DSM 4810

Gene: Bfae_03770: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Brevibacterium linens BL2

Gene: BlinB01003366: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649

Gene: JNB_09394: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Jonesia denitrificans DSM 20603

Gene: Jden_2093: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Kocuria rhizophila DC2201

Gene: KRH_00440: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Kytococcus sedentarius DSM 20547

Gene: Ksed_23150: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx16510: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
sufS
 
Arthrobacter aurescens TC1

Gene: AAur_2531: Cysteine desulfurase (EC 2.8.1.7)
 
Arthrobacter chlorophenolicus A6

Gene: Achl_2294: Cysteine desulfurase (EC 2.8.1.7)
 
Arthrobacter sp. FB24

Gene: Arth_2557: Cysteine desulfurase (EC 2.8.1.7)
 
Beutenbergia cavernae DSM 12333

Gene: Bcav_2773: Cysteine desulfurase (EC 2.8.1.7)
 
Brachybacterium faecium DSM 4810

Gene: Bfae_03780: Cysteine desulfurase (EC 2.8.1.7)
 
Brevibacterium linens BL2

Gene: BlinB01003367: Cysteine desulfurase (EC 2.8.1.7)
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201

Gene: KRH_00420: Cysteine desulfurase (EC 2.8.1.7)
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07

Gene: Lxx16520: Cysteine desulfurase (EC 2.8.1.7)
 
Renibacterium salmoninarum ATCC 33209

Gene: RSal33209_1521: Cysteine desulfurase (EC 2.8.1.7)
 
Tropheryma whipplei str. Twist
Cysteine desulfurase (EC 2.8.1.7)
 
CRON 2.
nrtR2
*
Arthrobacter aurescens TC1

Site:
position = -56
score = 6.15238
sequence = TTATCGTCAACTTGACGATAA

Site:
position = -11
score = 5.9121
sequence = TTATTGTCAAGATGACGATAA

Gene: AAur_3478: Nudix-related transcriptional regulator NrtR
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
Nudix-related transcriptional regulator NrtR
 
CRON 3.
PF01145
*
Arthrobacter aurescens TC1

Site:
position = -42
score = 6.15238
sequence = TTATCGTCAAGTTGACGATAA

Site:
position = -87
score = 5.9121
sequence = TTATCGTCATCTTGACAATAA

Gene: AAur_3479: band 7 protein
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
band 7 protein
nadF
 
Arthrobacter aurescens TC1

Gene: AAur_3480: ATP-NAD kinase, PpnK-type
 
Arthrobacter chlorophenolicus A6
 
Arthrobacter sp. FB24
 
Beutenbergia cavernae DSM 12333
 
Brachybacterium faecium DSM 4810
 
Brevibacterium linens BL2
 
Clavibacter michiganensis subsp. michiganensis NCPPB 382
 
Janibacter sp. HTCC2649
 
Jonesia denitrificans DSM 20603
 
Kocuria rhizophila DC2201
 
Kytococcus sedentarius DSM 20547
 
Leifsonia xyli subsp. xyli str. CTCB07
 
Renibacterium salmoninarum ATCC 33209
 
Tropheryma whipplei str. Twist
ATP-NAD kinase, PpnK-type
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD