Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Nakamurella multipartita DSM 44233
Frankia sp. EAN1pec 4 3
Frankia sp. CcI3 1 1
Acidothermus cellulolyticus 11B
Actinosynnema mirum DSM 43827
Saccharomonospora viridis DSM 43017
Saccharopolyspora erythraea NRRL 2338
Nocardioides sp. JS614
Propionibacterium acnes KPA171202
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadA
 
Nakamurella multipartita DSM 44233

Gene: Namu_3166: Quinolinate synthetase (EC 4.1.99.-)
*
Frankia sp. EAN1pec

Site:
position = -97
score = 5.37492
sequence = TTAGAGTCTGAACGACCATTA

Gene: Franean1_1796: Quinolinate synthetase (EC 4.1.99.-)
*
Frankia sp. CcI3

Site:
position = -106
score = 4.91899
sequence = TTAGAGTCTCATCGACCATTC

Gene: Francci3_3122: Quinolinate synthetase (EC 4.1.99.-)
 
Acidothermus cellulolyticus 11B

Gene: Acel_1145: Quinolinate synthetase (EC 4.1.99.-)
 
Actinosynnema mirum DSM 43827

Gene: Amir_5730: Quinolinate synthetase (EC 4.1.99.-)
 
Saccharomonospora viridis DSM 43017

Gene: Svir_10830: Quinolinate synthetase (EC 4.1.99.-)
 
Saccharopolyspora erythraea NRRL 2338

Gene: SACE_5803: Quinolinate synthetase (EC 4.1.99.-)
 
Nocardioides sp. JS614

Gene: Noca_3149: Quinolinate synthetase (EC 4.1.99.-)
 
Propionibacterium acnes KPA171202
Quinolinate synthetase (EC 4.1.99.-)
 
CRON 2.
PF01145
 
Nakamurella multipartita DSM 44233
*
Frankia sp. EAN1pec

Site:
position = -87
score = 4.65295
sequence = ATCTCGTCAGGTTGACGAGAA

Site:
position = -41
score = 6.1613
sequence = TTATCGTCAGTTCGACGATAA

Gene: Franean1_6652: band 7 protein
 
Frankia sp. CcI3
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
band 7 protein
nadF
 
Nakamurella multipartita DSM 44233
 
Frankia sp. EAN1pec

Gene: Franean1_6651: ATP-NAD kinase, PpnK-type
 
Frankia sp. CcI3
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
ATP-NAD kinase, PpnK-type
 
CRON 3.
nrtR
 
Nakamurella multipartita DSM 44233
*
Frankia sp. EAN1pec

Site:
position = -79
score = 6.1613
sequence = TTATCGTCGAACTGACGATAA

Site:
position = -33
score = 4.65295
sequence = TTCTCGTCAACCTGACGAGAT

Gene: Franean1_6653: Nudix-related transcriptional regulator NrtR
 
Frankia sp. CcI3
 
Acidothermus cellulolyticus 11B
 
Actinosynnema mirum DSM 43827
 
Saccharomonospora viridis DSM 43017
 
Saccharopolyspora erythraea NRRL 2338
 
Nocardioides sp. JS614
 
Propionibacterium acnes KPA171202
Nudix-related transcriptional regulator NrtR
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD