Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Chlorobiales

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Chlorobi
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Chlorobaculum parvum NCIB 8327 5 2
Chlorobium chlorochromatii CaD3 5 2
Chlorobium ferrooxidans DSM 13031 4 1
Chlorobium limicola DSM 245 10 2
Chlorobium phaeobacteroides BS1
Chlorobium phaeobacteroides DSM 266 9 3
Chloroherpeton thalassium ATCC 35110 5 2
Pelodictyon luteolum DSM 273 11 2
Pelodictyon phaeoclathratiforme BU-1 5 2
Prosthecochloris aestuarii DSM 271 7 2
Prosthecochloris vibrioformis DSM 265 11 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modD
*
Chlorobaculum parvum NCIB 8327

Site:
position = -151
score = 6.35588
sequence = AATCGTTATTTCCTGTAAGACATATCGAAA

Gene: Cpar_0446: Molybdenum transport system protein ModD
*
Chlorobium chlorochromatii CaD3

Site:
position = -29
score = 5.97806
sequence = CAGCGTTATAACCATAATCTCATAACGATA

Gene: Cag_0412: Molybdenum transport system protein ModD
 
Chlorobium ferrooxidans DSM 13031

Gene: CferDRAFT_1919: Molybdenum transport system protein ModD
*
Chlorobium limicola DSM 245

Site:
position = -44
score = 5.18299
sequence = GGTCGGAATAACCTGAAAGATATAACGAAA

Site:
position = -341
score = 5.99819
sequence = ATTCGTTATATTCTTATTTGCATAACGAAT

Gene: Clim_0375: Molybdenum transport system protein ModD
 
Chlorobium phaeobacteroides BS1

Gene: Cphamn1_1193: Molybdenum transport system protein ModD
*
Chlorobium phaeobacteroides DSM 266

Site:
position = -194
score = 5.35072
sequence = AAGCGTTATATTTGAAAACTCATTACGACC

Site:
position = -44
score = 5.03514
sequence = AACCGAAATACCTTTACTCATATAACGAAC

Gene: Cpha266_0455: Molybdenum transport system protein ModD
 
Chloroherpeton thalassium ATCC 35110

Gene: Ctha_2495: Molybdenum transport system protein ModD
*
Pelodictyon luteolum DSM 273

Site:
position = -51
score = 6.26676
sequence = TATCGGTATGCAAGCGATTACATAACGCTT

Gene: Plut_1707: Molybdenum transport system protein ModD
 
Pelodictyon phaeoclathratiforme BU-1

Gene: Ppha_0476: Molybdenum transport system protein ModD
 
Prosthecochloris aestuarii DSM 271

Gene: Paes_0908: Molybdenum transport system protein ModD
*2
Prosthecochloris vibrioformis DSM 265

Site:
position = -51
score = 6.34846
sequence = TATCGATATGCAAGCGATTACATAACGCTT

Gene: Cvib_0108: Molybdenum transport system protein ModD

Site:
position = -140
score = 5.00043
sequence = GTTCGCTATATTCAAATAAACATAACGGTT

Gene: Cvib_1491: Molybdenum transport system protein ModD
Molybdenum transport system protein ModD
modA
 2
Chlorobaculum parvum NCIB 8327

Gene: Cpar_1631: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Cpar_0445: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Chlorobium chlorochromatii CaD3

Gene: Cag_0413: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Chlorobium ferrooxidans DSM 13031

Site:
position = -45
score = 6.62875
sequence = CTCCGTTATTTCATATAATACATAACGAAA

Gene: CferDRAFT_1916: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Chlorobium limicola DSM 245

Gene: Clim_0675: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Clim_0374: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Chlorobium phaeobacteroides BS1

Gene: Cphamn1_0451: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Chlorobium phaeobacteroides DSM 266

Gene: Cpha266_0454: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Cpha266_0441: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Chloroherpeton thalassium ATCC 35110

Gene: Ctha_1429: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Ctha_2014: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Pelodictyon luteolum DSM 273

Gene: Plut_1708: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Plut_1541: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Pelodictyon phaeoclathratiforme BU-1

Gene: Ppha_0475: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Ppha_1998: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*2
Prosthecochloris aestuarii DSM 271

Site:
position = -61
score = 5.84598
sequence = TGACGTTATTACATTAAAAACATAACGAAA

Gene: Paes_1636: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Site:
position = -104
score = 6.02397
sequence = TTCCGTTGTATATTATAAGTTATAACGAGT

Gene: Paes_0414: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 2
Prosthecochloris vibrioformis DSM 265

Gene: Cvib_1492: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)

Gene: Cvib_0109: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Chlorobaculum parvum NCIB 8327

Gene: Cpar_0444: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Chlorobium chlorochromatii CaD3

Gene: Cag_0414: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Chlorobium ferrooxidans DSM 13031

Gene: CferDRAFT_1917: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 2
Chlorobium limicola DSM 245

Gene: Clim_0372: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Clim_0674: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Chlorobium phaeobacteroides BS1

Gene: Cphamn1_0453: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 2
Chlorobium phaeobacteroides DSM 266

Gene: Cpha266_0453: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Cpha266_0442: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 2
Chloroherpeton thalassium ATCC 35110

Gene: Ctha_1428: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Ctha_2013: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 2
Pelodictyon luteolum DSM 273

Gene: Plut_1542: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Plut_1709: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 2
Pelodictyon phaeoclathratiforme BU-1

Gene: Ppha_1999: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Ppha_0474: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 2
Prosthecochloris aestuarii DSM 271

Gene: Paes_1637: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Paes_0416: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 2
Prosthecochloris vibrioformis DSM 265

Gene: Cvib_0110: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Gene: Cvib_1493: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Chlorobaculum parvum NCIB 8327

Gene: Cpar_0443: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Chlorobium chlorochromatii CaD3

Gene: Cag_0415: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Chlorobium ferrooxidans DSM 13031

Gene: CferDRAFT_1918: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Chlorobium limicola DSM 245

Gene: Clim_0371: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Chlorobium phaeobacteroides BS1

Gene: Cphamn1_0454: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 2
Chlorobium phaeobacteroides DSM 266

Gene: Cpha266_0452: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: Cpha266_0438: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Chloroherpeton thalassium ATCC 35110

Gene: Ctha_2015: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 2
Pelodictyon luteolum DSM 273

Gene: Plut_1710: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: Plut_1712: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 2
Pelodictyon phaeoclathratiforme BU-1

Gene: Ppha_0473: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: Ppha_1995: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Prosthecochloris aestuarii DSM 271

Gene: Paes_0417: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 2
Prosthecochloris vibrioformis DSM 265

Gene: Cvib_0111: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: Cvib_1494: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
modX
*
Chlorobaculum parvum NCIB 8327

Site:
position = -90
score = 6.09225
sequence = ATTCGTTATATTTGTAAGAACATAACGAAT

Gene: Cpar_0441: Predicted molybdate-binding protein
 
Chlorobium chlorochromatii CaD3
 
Chlorobium ferrooxidans DSM 13031
 
Chlorobium limicola DSM 245

Gene: Clim_0373: Predicted molybdate-binding protein
 
Chlorobium phaeobacteroides BS1

Gene: Cphamn1_0452: Predicted molybdate-binding protein
*2
Chlorobium phaeobacteroides DSM 266

Site:
position = -266
score = 6.04426
sequence = TTCCGTTATTTTCTAAATTATATAACGCCA

Gene: Cpha266_0439: Predicted molybdate-binding protein

Gene: Cpha266_0436: Predicted molybdate-binding protein
*
Chloroherpeton thalassium ATCC 35110

Site:
position = -32
score = 5.85133
sequence = TTTCGTTATTTTCTCTTTGTTATAAGGCAA

Gene: Ctha_2016: Predicted molybdate-binding protein
 
Pelodictyon luteolum DSM 273

Gene: Plut_1711: Predicted molybdate-binding protein
*
Pelodictyon phaeoclathratiforme BU-1

Site:
position = -298
score = 5.60826
sequence = ATACGTTGTTTACTAAATTATATAACGGAA

Gene: Ppha_1996: Predicted molybdate-binding protein
 
Prosthecochloris aestuarii DSM 271

Gene: Paes_0415: Predicted molybdate-binding protein
 
Prosthecochloris vibrioformis DSM 265
Predicted molybdate-binding protein
omp_mod
 
Chlorobaculum parvum NCIB 8327

Gene: Cpar_1629: Predicted molybdenum transport TonB-dependent receptor
*
Chlorobium chlorochromatii CaD3

Site:
position = -51
score = 5.54552
sequence = GTGCGTTATATTTATAAATACATAACGAGC

Gene: Cag_1253: Predicted molybdenum transport TonB-dependent receptor
 
Chlorobium ferrooxidans DSM 13031
*
Chlorobium limicola DSM 245

Site:
position = -79
score = 6.45903
sequence = TACCGTTATACCTTTTATTATATAACGAAT

Gene: Clim_0676: Predicted molybdenum transport TonB-dependent receptor
 
Chlorobium phaeobacteroides BS1
*
Chlorobium phaeobacteroides DSM 266

Site:
position = -44
score = 6.17573
sequence = CATCGTTATATACTTATATTTATAACGAAA

Site:
position = -220
score = 6.04426
sequence = TGGCGTTATATAATTTAGAAAATAACGGAA

Gene: Cpha266_0440: Predicted molybdenum transport TonB-dependent receptor
*
Chloroherpeton thalassium ATCC 35110

Site:
position = -36
score = 6.02797
sequence = TAACGATATATATTAAAGTATATAACGAAT

Gene: Ctha_1484: Predicted molybdenum transport TonB-dependent receptor
*
Pelodictyon luteolum DSM 273

Site:
position = -156
score = 6.09545
sequence = TTTCGTTATATTCACACTTATATAACGAAT

Gene: Plut_1540: Predicted molybdenum transport TonB-dependent receptor
*
Pelodictyon phaeoclathratiforme BU-1

Site:
position = -153
score = 5.60826
sequence = TTCCGTTATATAATTTAGTAAACAACGTAT

Site:
position = -41
score = 5.75572
sequence = TTTCGCTATATTTTTAAGGTAATAACGAAT

Gene: Ppha_1997: Predicted molybdenum transport TonB-dependent receptor
 
Prosthecochloris aestuarii DSM 271
*
Prosthecochloris vibrioformis DSM 265

Site:
position = -47
score = 4.8241
sequence = CACCGTTATCACCTGAACAACACAACGAAA

Gene: Cvib_1353: Predicted molybdenum transport TonB-dependent receptor
Predicted molybdenum transport TonB-dependent receptor
modE
 
Chlorobaculum parvum NCIB 8327

Gene: Cpar_1630: Molybdate-responsive transcriptional regulator ModE
 
Chlorobium chlorochromatii CaD3

Gene: Cag_1230: Molybdate-responsive transcriptional regulator ModE
 
Chlorobium ferrooxidans DSM 13031

Gene: CferDRAFT_1920: Molybdate-responsive transcriptional regulator ModE
 
Chlorobium limicola DSM 245

Gene: Clim_0673: Molybdate-responsive transcriptional regulator ModE
 
Chlorobium phaeobacteroides BS1
 
Chlorobium phaeobacteroides DSM 266

Gene: Cpha266_0735: Molybdate-responsive transcriptional regulator ModE
 
Chloroherpeton thalassium ATCC 35110

Gene: Ctha_1482: Molybdate-responsive transcriptional regulator ModE
 
Pelodictyon luteolum DSM 273

Gene: Plut_1543: Molybdate-responsive transcriptional regulator ModE
 
Pelodictyon phaeoclathratiforme BU-1

Gene: Ppha_1986: Molybdate-responsive transcriptional regulator ModE
 
Prosthecochloris aestuarii DSM 271

Gene: Paes_1638: Molybdate-responsive transcriptional regulator ModE
 
Prosthecochloris vibrioformis DSM 265

Gene: Cvib_1354: Molybdate-responsive transcriptional regulator ModE
Molybdate-responsive transcriptional regulator ModE
moaA
 
Chlorobaculum parvum NCIB 8327

Gene: Cpar_1349: Molybdenum cofactor biosynthesis protein MoaA
 
Chlorobium chlorochromatii CaD3
 
Chlorobium ferrooxidans DSM 13031
 
Chlorobium limicola DSM 245

Gene: Clim_0672: Molybdenum cofactor biosynthesis protein MoaA
 
Chlorobium phaeobacteroides BS1
 
Chlorobium phaeobacteroides DSM 266

Gene: Cpha266_0734: Molybdenum cofactor biosynthesis protein MoaA
 
Chloroherpeton thalassium ATCC 35110

Gene: Ctha_0875: Molybdenum cofactor biosynthesis protein MoaA
 
Pelodictyon luteolum DSM 273

Gene: Plut_1544: Molybdenum cofactor biosynthesis protein MoaA
 
Pelodictyon phaeoclathratiforme BU-1

Gene: Ppha_1339: Molybdenum cofactor biosynthesis protein MoaA
 
Prosthecochloris aestuarii DSM 271

Gene: Paes_2126: Molybdenum cofactor biosynthesis protein MoaA
 
Prosthecochloris vibrioformis DSM 265

Gene: Cvib_1355: Molybdenum cofactor biosynthesis protein MoaA
Molybdenum cofactor biosynthesis protein MoaA
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD