Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ModE - Alcaligenaceae

Properties
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bordetella avium 197N 3 1
Bordetella bronchiseptica RB50 3 1
Bordetella petrii DSM 12804 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
modA
*
Bordetella avium 197N

Site:
position = -65
score = 6.79221
sequence = ATCGTTATATACAAGGCTATATTTCGAT

Gene: BAV2468: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Bordetella bronchiseptica RB50

Site:
position = -95
score = 7.10819
sequence = TTCGTTATATATTCCACTACATAACGCT

Gene: BB0825: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Bordetella petrii DSM 12804

Site:
position = -51
score = 6.98369
sequence = TTCGTTATATAGTTCAGTTTATAGCGAG

Gene: Bpet0724: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
 
Bordetella avium 197N

Gene: BAV2467: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Bordetella bronchiseptica RB50

Gene: BB0824: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Bordetella petrii DSM 12804

Gene: Bpet0725: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Bordetella avium 197N

Gene: BAV2466: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Bordetella bronchiseptica RB50

Gene: BB0823: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Bordetella petrii DSM 12804

Gene: Bpet0726: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD