Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GntR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: Gluconate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155 2 2
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gntK
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -30
score = 5.72335
sequence = GTAGGTTACCGGTAACATGT

Site:
position = -16
score = 5.6101
sequence = ACATGTTACCCGTAATATGA

Gene: Sbal_4087: Gluconokinase (EC 2.7.1.12)
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Gluconokinase (EC 2.7.1.12)
 
CRON 2.
gntU
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
*
Shewanella baltica OS155

Site:
position = -74
score = 5.6101
sequence = TCATATTACGGGTAACATGT

Site:
position = -60
score = 5.72335
sequence = ACATGTTACCGGTAACCTAC

Gene: Sbal_4088: Low-affinity gluconate/H+ symporter GntU
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Low-affinity gluconate/H+ symporter GntU
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD