Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 6 2
Clostridium beijerincki NCIMB 8052 2 1
Clostridium botulinum A str. ATCC 3502
Clostridium butyricum 5521
Clostridium kluyveri DSM 555
Clostridium novyi NT
Clostridium perfringens ATCC 13124
Clostridium tetani E88
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtR
*
Clostridium acetobutylicum ATCC 824

Site:
position = -75
score = 6.31036
sequence = TTTGTATCAAAATGATGCTAA

Site:
position = -53
score = 5.55685
sequence = ATAGTTTTAATATGATACAAA

Gene: CAC1777: Nudix-related transcriptional regulator NrtR
*
Clostridium beijerincki NCIMB 8052

Site:
position = -69
score = 5.64995
sequence = ATAGAATCAAATTGATATTAT

Gene: Cbei_2075: Nudix-related transcriptional regulator NrtR
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Nudix-related transcriptional regulator NrtR
prs
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_2076: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
pncA
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1778: Nicotinamidase (EC 3.5.1.19)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_2077: Nicotinamidase (EC 3.5.1.19)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1134: Nicotinamidase (EC 3.5.1.19)
 
Clostridium butyricum 5521

Gene: CBY_1219: Nicotinamidase (EC 3.5.1.19)
 
Clostridium kluyveri DSM 555

Gene: CKL_2731: Nicotinamidase (EC 3.5.1.19)
 
Clostridium novyi NT

Gene: NT01CX_2341: Nicotinamidase (EC 3.5.1.19)
 
Clostridium perfringens ATCC 13124

Gene: CPF_0569: Nicotinamidase (EC 3.5.1.19)
 
Clostridium tetani E88

Gene: CTC00699: Nicotinamidase (EC 3.5.1.19)
Nicotinamidase (EC 3.5.1.19)
 
CRON 2.
CAC1779
*
Clostridium acetobutylicum ATCC 824

Site:
position = -169
score = 4.93426
sequence = TTAGCTTTATTTTTATACAAA

Site:
position = -102
score = 6.49231
sequence = TTTGTATCATATTGGTACAAA

Site:
position = -39
score = 6.18943
sequence = TTTGTATCAATATAGTACAAA

Gene: CAC1779: hypothetical protein
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
hypothetical protein
pncB
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1780: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadD
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1781: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18)
nadE
 
Clostridium acetobutylicum ATCC 824

Gene: CAC1782: NAD synthetase (EC 6.3.1.5)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
NAD synthetase (EC 6.3.1.5)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD