Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PhnR1 - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Aeromonas hydrophila subsp. hydrophila ATCC 7966 7 2
Aeromonas salmonicida subsp. salmonicida A449 7 2
Tolumonas auensis DSM 9187
Moritella sp. PE36
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
phnR1
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -218
score = 5.55298
sequence = CCTCTGGACTAGGTCAGTTA

Site:
position = -76
score = 5.93331
sequence = AAGCTGGACTACTCCAGCAA

Gene: AHA_3982: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -223
score = 5.55298
sequence = CCTCTGGACTAGGTCAGTTA

Site:
position = -82
score = 5.70632
sequence = ACGCTGGTCTACTCCAGCGG

Gene: ASA_4028: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
2-aminoethylphosphonate uptake and metabolism regulator, GntR family
 
CRON 2.
phnS
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -294
score = 5.93331
sequence = TTGCTGGAGTAGTCCAGCTT

Site:
position = -152
score = 5.55298
sequence = TAACTGACCTAGTCCAGAGG

Gene: AHA_3983: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -26
score = 5.55298
sequence = TAACTGACCTAGTCCAGAGG

Site:
position = -167
score = 5.70632
sequence = CCGCTGGAGTAGACCAGCGT

Gene: ASA_4029: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36

Gene: PE36_07142: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
AHA_3984
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3984: type I phosphodiesterase
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4030: type I phosphodiesterase
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36

Gene: PE36_07147: type I phosphodiesterase
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
type I phosphodiesterase
phnU
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3985: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4031: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36

Gene: PE36_07152: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnV
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3986: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4032: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36

Gene: PE36_07157: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnT
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3987: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4033: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36

Gene: PE36_07162: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
COG0560
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3988: Phosphoserine phosphatase (EC 3.1.3.3)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4034: Phosphoserine phosphatase (EC 3.1.3.3)
 
Tolumonas auensis DSM 9187
 
Moritella sp. PE36

Gene: PE36_07167: Phosphoserine phosphatase (EC 3.1.3.3)
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
Phosphoserine phosphatase (EC 3.1.3.3)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD