Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CD1503 - Clostridia-2

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium bartlettii DSM 16795 3 1
Clostridium difficile 630 3 1
Clostridium hiranonis DSM 13275 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
CD1503
*
Clostridium bartlettii DSM 16795

Site:
position = -45
score = 7.30821
sequence = TATGGTTAATTACTTGAGTAACTAACTATA

Gene: CLOBAR_01627: Transcriptional regulator, GntR family
*
Clostridium difficile 630

Site:
position = -47
score = 6.84754
sequence = TATAGTTAATTAGTTGAGTAACTAACTAAT

Gene: CD1503: Transcriptional regulator, GntR family
*
Clostridium hiranonis DSM 13275

Site:
position = -68
score = 6.32758
sequence = AGGAGTTAGTTACTTGACTAACTAACCAAT

Gene: CLOHIR_01288: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
lp_2743
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_01628: ABC-type multidrug transport system, ATPase component
 
Clostridium difficile 630

Gene: CD1504: ABC-type multidrug transport system, ATPase component
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_01289: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
lp_2744
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_01629: ABC-type multidrug transport system, permease component
 
Clostridium difficile 630

Gene: CD1505: ABC-type multidrug transport system, permease component
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_01290: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD