Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CBO1205 - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux; Macrolides efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824
Clostridium beijerincki NCIMB 8052
Clostridium botulinum A str. ATCC 3502 3 1
Clostridium butyricum 5521
Clostridium kluyveri DSM 555
Clostridium novyi NT
Clostridium perfringens ATCC 13124
Clostridium tetani E88 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
CTC01688
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
*
Clostridium tetani E88

Site:
position = -39
score = 5.96904
sequence = TATACTTAGTTATATTAGTAACTAACCAAT

Gene: CTC01688: hypothetical protein
hypothetical protein
CBO1205
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -50
score = 6.55364
sequence = TATAGTTAGTCATATAAGTAATTAACCAAC

Gene: CBO1205: Transcriptional regulator, GntR family
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88

Gene: CTC01687: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
CTC01686
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88

Gene: CTC01686: hypothetical protein
hypothetical protein
lp_2743
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1206: ABC-type multidrug transport system, ATPase component
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88

Gene: CTC01685: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
CTC01684
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88

Gene: CTC01684: hypothetical protein
hypothetical protein
lp_2744
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1207: ABC-type multidrug transport system, permease component
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
*
Clostridium tetani E88

Site:
position = -94
score = 6.65061
sequence = TATAGTTAGTTATACATGTAACTAACCAAC

Gene: CTC01397: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD