Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BC2903 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579 4 2
Bacillus clausii KSM-K16 6 2
Bacillus halodurans C-125 3 1
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831 6 2
Paenibacillus sp. JDR-2 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BC2903
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
*2
Bacillus cereus ATCC 14579

Site:
position = -50
score = 7.01741
sequence = TATGGTTAATTACATAAGTAATGAACCTAT

Gene: BC2904: Transcriptional regulator, GntR family

Site:
position = -228
score = 7.01741
sequence = TATGGTTAATTACATAAGTAATGAACCTAT

Gene: BC2903: Transcriptional regulator, GntR family
*2
Bacillus clausii KSM-K16

Site:
position = -89
score = 6.12324
sequence = TATGGTTAACTACATAACCAGCTAACCAAA

Gene: ABC0622: Transcriptional regulator, GntR family

Site:
position = -52
score = 6.22765
sequence = TATAGTTGATTACACTACTAATCAACCAAT

Gene: ABC3409: Transcriptional regulator, GntR family
*
Bacillus halodurans C-125

Site:
position = -39
score = 7.21623
sequence = TATGGTTAGTTACATAAGTAATGAACCAAG

Gene: BH3492: Transcriptional regulator, GntR family
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
*2
Oceanobacillus iheyensis HTE831

Site:
position = -62
score = 5.51674
sequence = TATAGTTATACACATGAGTATATAACCGTA

Gene: OB0429: Transcriptional regulator, GntR family

Site:
position = -46
score = 7.31605
sequence = TATGGTTAGTTACATAAGTAATTAACCAAT

Gene: OB0885: Transcriptional regulator, GntR family
*
Paenibacillus sp. JDR-2

Site:
position = -58
score = 6.65234
sequence = TATAGTTGATTACATGAGTAACCAACCACT

Gene: Pjdr2_5967: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
lp_2743
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC2902: ABC-type multidrug transport system, ATPase component
 2
Bacillus clausii KSM-K16

Gene: ABC0621: ABC-type multidrug transport system, ATPase component

Gene: ABC3408: ABC-type multidrug transport system, ATPase component
 
Bacillus halodurans C-125

Gene: BH3493: ABC-type multidrug transport system, ATPase component
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 2
Oceanobacillus iheyensis HTE831

Gene: OB0428: ABC-type multidrug transport system, ATPase component

Gene: OB0886: ABC-type multidrug transport system, ATPase component
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5968: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
lp_2744
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC2901: ABC-type multidrug transport system, permease component
 2
Bacillus clausii KSM-K16

Gene: ABC0620: ABC-type multidrug transport system, permease component

Gene: ABC3407: ABC-type multidrug transport system, permease component
 
Bacillus halodurans C-125

Gene: BH3494: ABC-type multidrug transport system, permease component
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 2
Oceanobacillus iheyensis HTE831

Gene: OB0427: ABC-type multidrug transport system, permease component

Gene: OB0887: ABC-type multidrug transport system, permease component
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5969: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD