Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Csac_2166 - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725 5 1
Caldicellulosiruptor saccharolyticus DSM 8903 5 1
Carboxydothermus hydrogenoformans Z-2901 4 1
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514 4 1
Thermoanaerobacter italicus Ab9
Thermoanaerobacter tengcongensis MB4 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Csac_2166
*
Anaerocellum thermophilum DSM 6725

Site:
position = -50
score = 7.50011
sequence = AGTGTTATATAATTATATAACACT

Gene: Athe_0959: hypothetical protein
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -50
score = 7.50011
sequence = AGTGTTATATAATTATATAACACT

Gene: Csac_2166: hypothetical protein
*
Carboxydothermus hydrogenoformans Z-2901

Site:
position = -50
score = 7.05463
sequence = ACTGTTATATAATTATATAACAGC

Gene: CHY_0445: hypothetical protein
 
Moorella thermoacetica ATCC 39073
*
Thermoanaerobacter ethanolicus X514

Site:
position = -47
score = 7.40301
sequence = AGTGTTATATAATTATATAACAGT

Gene: Teth514_0375: hypothetical protein
 
Thermoanaerobacter italicus Ab9
*
Thermoanaerobacter tengcongensis MB4

Site:
position = -49
score = 7.20744
sequence = ACTGTTATATTATTATATAACAGT

Gene: TTE0439: hypothetical protein
hypothetical protein
Csac_2166
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0960: Transcriptional regulator, GntR family
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2165: Transcriptional regulator, GntR family
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0446: Transcriptional regulator, GntR family
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0374: Transcriptional regulator, GntR family
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0438: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
THA_1502
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0961: ABC transporter, permease protein
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2164: ABC transporter, permease protein
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0447: ABC transporter, permease protein
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0373: ABC transporter, permease protein
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0437: ABC transporter, permease protein
ABC transporter, permease protein
Athe_0962
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0962: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2163: dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4
dipeptidyl aminopeptidase/acylaminoacyl-peptidase-like protein
THA_1501
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0963: ABC transporter, ATP-binding protein
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2162: ABC transporter, ATP-binding protein
 
Carboxydothermus hydrogenoformans Z-2901

Gene: CHY_0448: ABC transporter, ATP-binding protein
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514

Gene: Teth514_0372: ABC transporter, ATP-binding protein
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4

Gene: TTE0436: ABC transporter, ATP-binding protein
ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD