Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ELI_12480 - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Proteobacteria/Alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 23 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594 7 4
Erythrobacter sp. NAP1 9 5
Novosphingobium aromaticivorans DSM 12444 6 3
Sphingobium japonicum UT26S 7 4
Sphingopyxis alaskensis RB2256 7 4
Sphingomonas wittichii RW1 5 3
Zymomonas mobilis subsp. mobilis ZM4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
NAP1_15423
 
Erythrobacter litoralis HTCC2594
*
Erythrobacter sp. NAP1

Site:
position = -60
score = 4.92844
sequence = AGGCGCTTTACACAAGTAACACACCA

Gene: NAP1_15423: ABC transporter ATP-binding protein
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingobium japonicum UT26S
 
Sphingopyxis alaskensis RB2256
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
ABC transporter ATP-binding protein
NAP1_15428
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1

Gene: NAP1_15428: membrane protein, putative
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingobium japonicum UT26S
 
Sphingopyxis alaskensis RB2256
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
membrane protein, putative
 
CRON 2.
pbp
*
Erythrobacter litoralis HTCC2594

Site:
position = -28
score = 4.11019
sequence = CGCTGTGTTATCCTGCTAATACAGCC

Gene: ELI_02675: penicillin-binding protein
*
Erythrobacter sp. NAP1

Site:
position = -30
score = 4.05533
sequence = GGCTGTATTAGGCTGCTAACACAGTG

Gene: NAP1_01960: penicillin-binding protein
 
Novosphingobium aromaticivorans DSM 12444
*
Sphingobium japonicum UT26S

Site:
position = -25
score = 4.13001
sequence = GACCGTGTCAGGCAAATAACACAGCA

Gene: SJA_C1-22810: penicillin-binding protein
*
Sphingopyxis alaskensis RB2256

Site:
position = 1
score = 3.78096
sequence = TGCTGTGTTGGGGTTGTAATACGGCC

Gene: Sala_1453: penicillin-binding protein
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
penicillin-binding protein
 
CRON 3.
ELI_11155
*
Erythrobacter litoralis HTCC2594

Site:
position = -49
score = 4.36744
sequence = TCGTGTCTTAGACACCTAATACAGTT

Gene: ELI_11155: Uncharacterized protein involved in tellurite resistance
*
Erythrobacter sp. NAP1

Site:
position = -90
score = 4.87887
sequence = GCGTGTTTTAGATCACTAATACAGTA

Gene: NAP1_15233: Uncharacterized protein involved in tellurite resistance
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -49
score = 4.30667
sequence = CGCTGTGTTGCGTGTATAAGACAGCT

Gene: Saro_2959: Uncharacterized protein involved in tellurite resistance
*
Sphingobium japonicum UT26S

Site:
position = -55
score = 4.36897
sequence = AACTGTTCTATACGCATATAACAGTT

Gene: SJA_C1-07830: Uncharacterized protein involved in tellurite resistance
*
Sphingopyxis alaskensis RB2256

Site:
position = -85
score = 4.7397
sequence = CAGTGTAATGCTTGTATAATACAGTG

Gene: Sala_2308: Uncharacterized protein involved in tellurite resistance
*
Sphingomonas wittichii RW1

Site:
position = -72
score = 3.3402
sequence = CGCCGTATCGCTTGAATAATGCACCC

Gene: Swit_0261: Uncharacterized protein involved in tellurite resistance
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO1385: Uncharacterized protein involved in tellurite resistance
Uncharacterized protein involved in tellurite resistance
ELI_11160
 
Erythrobacter litoralis HTCC2594

Gene: ELI_11160: hypothetical protein
 
Erythrobacter sp. NAP1

Gene: NAP1_15228: hypothetical protein
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_2958: hypothetical protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-07820: hypothetical protein
 
Sphingopyxis alaskensis RB2256

Gene: Sala_2309: hypothetical protein
 
Sphingomonas wittichii RW1

Gene: Swit_0260: hypothetical protein
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO1386: hypothetical protein
hypothetical protein
 
CRON 4.
rndA
*
Erythrobacter litoralis HTCC2594

Site:
position = -55
score = 4.52015
sequence = AGGTGACTTATATAGGTAATACAGCG

Gene: ELI_13485: RND family efflux transporter MFP subunit
*
Erythrobacter sp. NAP1

Site:
position = -73
score = 4.3934
sequence = GGGTGACTTATACGTATAACACACTT

Gene: NAP1_12603: RND family efflux transporter MFP subunit
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -81
score = 4.67271
sequence = AAGTGTGTTATATGTATAGCACGCTA

Gene: Saro_0040: RND family efflux transporter MFP subunit
*
Sphingobium japonicum UT26S

Site:
position = -63
score = 5.17902
sequence = GGGTGATGTATTCATATAATACAGCA

Gene: SJA_C1-02860: RND family efflux transporter MFP subunit
*
Sphingopyxis alaskensis RB2256

Site:
position = -100
score = 4.85875
sequence = CGGTGATTTAATTAGGTAATACACCT

Gene: Sala_0471: RND family efflux transporter MFP subunit
*
Sphingomonas wittichii RW1

Site:
position = -70
score = 4.18177
sequence = AGGTGACGTATTGAGATAATACAGCT

Gene: Swit_4745: RND family efflux transporter MFP subunit
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0287: RND family efflux transporter MFP subunit
RND family efflux transporter MFP subunit
rndB
 
Erythrobacter litoralis HTCC2594

Gene: ELI_13490: RND multidrug efflux transporter transmembrane subunit
 
Erythrobacter sp. NAP1

Gene: NAP1_12598: RND multidrug efflux transporter transmembrane subunit
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0039: RND multidrug efflux transporter transmembrane subunit
 
Sphingobium japonicum UT26S

Gene: SJA_C1-02870: RND multidrug efflux transporter transmembrane subunit
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0472: RND multidrug efflux transporter transmembrane subunit
 
Sphingomonas wittichii RW1

Gene: Swit_4744: RND multidrug efflux transporter transmembrane subunit
 
Zymomonas mobilis subsp. mobilis ZM4
RND multidrug efflux transporter transmembrane subunit
COG2733
 
Erythrobacter litoralis HTCC2594

Gene: ELI_13495: Predicted membrane protein
 
Erythrobacter sp. NAP1

Gene: NAP1_12593: Predicted membrane protein
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_0038: Predicted membrane protein
 
Sphingobium japonicum UT26S

Gene: SJA_C1-02880: Predicted membrane protein
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0473: Predicted membrane protein
 
Sphingomonas wittichii RW1

Gene: Swit_4743: Predicted membrane protein
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO0290: Predicted membrane protein
Predicted membrane protein
 
CRON 5.
ELI_12480
*
Erythrobacter litoralis HTCC2594

Site:
position = -26
score = 4.37228
sequence = CGGTGTATTATGGCACTGAAGCACCC

Gene: ELI_12480: Transcriptional regulator, GntR family
*
Erythrobacter sp. NAP1

Site:
position = -41
score = 3.76632
sequence = GGCTGTATTATGGCACTGAAGCACCT

Gene: NAP1_13568: Transcriptional regulator, GntR family
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = 22
score = 4.29006
sequence = GGCTGTATTATGGCAATATAGCACCC

Gene: Saro_0164: Transcriptional regulator, GntR family
*
Sphingobium japonicum UT26S

Site:
position = -25
score = 4.29986
sequence = CGCTGTATTATGGCACTGATGCACCA

Gene: SJA_C1-23280: Transcriptional regulator, GntR family
*
Sphingopyxis alaskensis RB2256

Site:
position = -25
score = 4.74838
sequence = TGCTGTCTTATGGCATTAAGTCGCCA

Gene: Sala_0952: Transcriptional regulator, GntR family
*
Sphingomonas wittichii RW1

Site:
position = -25
score = 4.83064
sequence = TGCTGTGTTAGCACAGTGTGACGCCA

Gene: Swit_0076: Transcriptional regulator, GntR family
 
Zymomonas mobilis subsp. mobilis ZM4
Transcriptional regulator, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD