Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LndYR - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Antibiotic resistance
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 4 1
Streptomyces coelicolor A3(2) 3 1
Streptomyces griseus subsp. griseus NBRC 13350 9 3
Streptomyces scabiei 87.22 7 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
lndYR
*
Streptomyces avermitilis MA-4680

Site:
position = -25
score = 5.87345
sequence = CTTTCACTACTCAATTAGTGAAAG

Gene: SAV_4065: Transcriptional regulator of landomycin production, GntR family
*
Streptomyces coelicolor A3(2)

Site:
position = -25
score = 5.41185
sequence = CTTCTACTAATGAATTAATGAAAG

Gene: SCO0823: Transcriptional regulator of landomycin production, GntR family
*2
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -25
score = 5.87345
sequence = CTTTCACTACTCAATTAGTGAAAG

Gene: SGR_3939: Transcriptional regulator of landomycin production, GntR family

Gene: SGR_3238: Transcriptional regulator of landomycin production, GntR family
*2
Streptomyces scabiei 87.22

Site:
position = -28
score = 5.4846
sequence = AAATCACTAGTCGACTAGTGAATT

Gene: SCAB_53951: Transcriptional regulator of landomycin production, GntR family

Site:
position = -36
score = 5.87345
sequence = CTTTCACTACTCAATTAGTGAAAG

Gene: SCAB_49471: Transcriptional regulator of landomycin production, GntR family
Transcriptional regulator of landomycin production, GntR family
lndWA
 
Streptomyces avermitilis MA-4680

Gene: SAV_4066: Landomycin ABC transporter, ATP-binding protein
 
Streptomyces coelicolor A3(2)

Gene: SCO0824: Landomycin ABC transporter, ATP-binding protein
*2
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3938: Landomycin ABC transporter, ATP-binding protein

Site:
position = -28
score = 5.6678
sequence = ATTCCATTAATTGACTAATGGAAT

Gene: SGR_3236: Landomycin ABC transporter, ATP-binding protein
 2
Streptomyces scabiei 87.22

Gene: SCAB_49461: Landomycin ABC transporter, ATP-binding protein

Gene: SCAB_53961: Landomycin ABC transporter, ATP-binding protein
Landomycin ABC transporter, ATP-binding protein
lndWP
 2
Streptomyces avermitilis MA-4680

Gene: SAV_4068: Landomycin ABC transporter, permease protein

Gene: SAV_4067: Landomycin ABC transporter, permease protein
 
Streptomyces coelicolor A3(2)

Gene: SCO0825: Landomycin ABC transporter, permease protein
 2
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_3937: Landomycin ABC transporter, permease protein

Gene: SGR_3237: Landomycin ABC transporter, permease protein
 3
Streptomyces scabiei 87.22

Gene: SCAB_49441: Landomycin ABC transporter, permease protein

Gene: SCAB_53971: Landomycin ABC transporter, permease protein

Gene: SCAB_49451: Landomycin ABC transporter, permease protein
Landomycin ABC transporter, permease protein
 
CRON 2.
SGR_2538
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -22
score = 4.60146
sequence = ATAGTGCTAGGCAACTAGATAAAT

Gene: SGR_2538: putative GntR-family transcriptional regulator
 
Streptomyces scabiei 87.22
putative GntR-family transcriptional regulator
SGR_2537
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_2537: putative ABC transporter ATP-binding protein
 
Streptomyces scabiei 87.22
putative ABC transporter ATP-binding protein
SGR_2536
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_2536: putative transmembrane transport protein
 
Streptomyces scabiei 87.22
putative transmembrane transport protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD