Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CD0652 - Clostridia-2

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium bartlettii DSM 16795
Clostridium difficile 630 6 2
Clostridium hiranonis DSM 13275 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
CD0652
 
Clostridium bartlettii DSM 16795
*2
Clostridium difficile 630

Site:
position = -48
score = 7.36232
sequence = TTTATATAATGTGTATATACTATATATACAATTTAAGGA

Gene: CD2023: Transcriptional regulator, GntR family

Site:
position = -60
score = 5.24172
sequence = AGTGTATAGTGTGTATATAATAACATCACACTGAAAATG

Gene: CD0652: Transcriptional regulator, GntR family
*
Clostridium hiranonis DSM 13275

Site:
position = -104
score = 6.50176
sequence = TGTATATAGTGTATATACAGTTGACAGAATTTATATACA

Site:
position = -115
score = 6.6032
sequence = TTAAAAAATTGTGTATATAGTGTATATACAGTTGACAGA

Site:
position = -63
score = 6.98616
sequence = GTTATTATGTGTATATAGATAATATATACAGTATATACA

Gene: CLOHIR_00432: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
BH0652
 
Clostridium bartlettii DSM 16795
 2
Clostridium difficile 630

Gene: CD2024: ABC-type multidrug transport system, ATPase component

Gene: CD0653: ABC-type multidrug transport system, ATPase component
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_00433: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
BH0653
 
Clostridium bartlettii DSM 16795
 2
Clostridium difficile 630

Gene: CD0654: ABC-type multidrug transport system, permease component

Gene: CD2025: ABC-type multidrug transport system, permease component
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_00434: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD