Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Cbei_4343 - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824
Clostridium beijerincki NCIMB 8052 3 1
Clostridium botulinum A str. ATCC 3502 4 2
Clostridium butyricum 5521
Clostridium kluyveri DSM 555 3 1
Clostridium novyi NT 3 1
Clostridium perfringens ATCC 13124 4 1
Clostridium tetani E88 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Cbei_4343
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -60
score = 8.78449
sequence = TGTTCATACTGTATATATTGTATATATACAGTATGAACA

Gene: Cbei_4343: Transcriptional regulator, GntR family
*2
Clostridium botulinum A str. ATCC 3502

Site:
position = -61
score = 8.20342
sequence = AACACATACTGTATATATTATATATATACAGTATGTACG

Gene: CBO2918: Transcriptional regulator, GntR family

Site:
position = -55
score = 5.9812
sequence = TGTGTATAGTGTGTATTGTACATATACACACTGATTATG

Gene: CBO2066: Transcriptional regulator, GntR family
 
Clostridium butyricum 5521
*
Clostridium kluyveri DSM 555

Site:
position = -51
score = 8.1621
sequence = TGTGAACATTGTATATATTATATATATACAATGTTCACA

Gene: CKL_0385: Transcriptional regulator, GntR family
*
Clostridium novyi NT

Site:
position = -54
score = 9.17523
sequence = TGTATATACTGTATATAAAGAATATATACAGTATATACA

Gene: NT01CX_2435: Transcriptional regulator, GntR family
*
Clostridium perfringens ATCC 13124

Site:
position = -56
score = 9.32793
sequence = TGTATATACTGTATATATAGAATATATACAGTATATACA

Gene: CPF_0445: Transcriptional regulator, GntR family
*2
Clostridium tetani E88

Gene: CTC01893: Transcriptional regulator, GntR family

Site:
position = -55
score = 8.70897
sequence = TGTATATACTGTATATATACGATATGCACAGTATATACA

Gene: CTC00804: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
BH0652
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4342: ABC-type multidrug transport system, ATPase component
 2
Clostridium botulinum A str. ATCC 3502

Gene: CBO2917: ABC-type multidrug transport system, ATPase component

Gene: CBO2065: ABC-type multidrug transport system, ATPase component
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_0384: ABC-type multidrug transport system, ATPase component
 
Clostridium novyi NT

Gene: NT01CX_2434: ABC-type multidrug transport system, ATPase component
 
Clostridium perfringens ATCC 13124

Gene: CPF_0446: ABC-type multidrug transport system, ATPase component
 2
Clostridium tetani E88

Gene: CTC01892: ABC-type multidrug transport system, ATPase component

Gene: CTC00803: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
BH0653
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4341: ABC-type multidrug transport system, permease component
 2
Clostridium botulinum A str. ATCC 3502

Gene: CBO2916: ABC-type multidrug transport system, permease component

Gene: CBO2064: ABC-type multidrug transport system, permease component
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_0383: ABC-type multidrug transport system, permease component
 
Clostridium novyi NT

Gene: NT01CX_2433: ABC-type multidrug transport system, permease component
 2
Clostridium perfringens ATCC 13124

Gene: CPF_0447: ABC-type multidrug transport system, permease component

Gene: CPF_0448: ABC-type multidrug transport system, permease component
 5
Clostridium tetani E88

Gene: CTC00802: ABC-type multidrug transport system, permease component

Gene: CTC00800: ABC-type multidrug transport system, permease component

Gene: CTC01891: ABC-type multidrug transport system, permease component

Gene: CTC00799: ABC-type multidrug transport system, permease component

Gene: CTC00801: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD