Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Csac_2497 - Thermoanaerobacterales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anaerocellum thermophilum DSM 6725 3 1
Caldicellulosiruptor saccharolyticus DSM 8903 3 1
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514
Thermoanaerobacter italicus Ab9
Thermoanaerobacter tengcongensis MB4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Csac_2497
*
Anaerocellum thermophilum DSM 6725

Site:
position = -45
score = 6.24076
sequence = TGTATATACTGTATATATACAGTATGCAAAAGGAGAAAG

Site:
position = -54
score = 7.63869
sequence = AATTAAAACTGTATATACTGTATATATACAGTATGCAAA

Gene: Athe_0118: Transcriptional regulator, GntR family
*
Caldicellulosiruptor saccharolyticus DSM 8903

Site:
position = -45
score = 6.13943
sequence = TGTATATACTGTATATATACAGTATGCAAAAGGGGAAAG

Site:
position = -54
score = 7.63869
sequence = AATTAAAACTGTATATACTGTATATATACAGTATGCAAA

Gene: Csac_2497: Transcriptional regulator, GntR family
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4
Transcriptional regulator, GntR family
BH0652
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0117: ABC-type multidrug transport system, ATPase component
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2498: ABC-type multidrug transport system, ATPase component
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4
ABC-type multidrug transport system, ATPase component
BH0653
 
Anaerocellum thermophilum DSM 6725

Gene: Athe_0116: ABC-type multidrug transport system, permease component
 
Caldicellulosiruptor saccharolyticus DSM 8903

Gene: Csac_2499: ABC-type multidrug transport system, permease component
 
Carboxydothermus hydrogenoformans Z-2901
 
Moorella thermoacetica ATCC 39073
 
Thermoanaerobacter ethanolicus X514
 
Thermoanaerobacter italicus Ab9
 
Thermoanaerobacter tengcongensis MB4
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD