Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BH0651 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579 6 1
Bacillus clausii KSM-K16 5 2
Bacillus halodurans C-125 3 1
Bacillus licheniformis DSM 13 6 2
Bacillus pumilus SAFR-032 3 1
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BH0651
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
*
Bacillus cereus ATCC 14579

Site:
position = -55
score = 8.91486
sequence = TGTATATACTGTATATATAAGGTATATACAGTATATACA

Gene: BC4222: Transcriptional regulator, GntR family
*
Bacillus clausii KSM-K16

Site:
position = -306
score = 6.96126
sequence = TGTATATGATGGGCATATAGTATATATACATTATATGAA

Gene: ABC0260: Transcriptional regulator, GntR family
*
Bacillus halodurans C-125

Site:
position = -157
score = 8.67992
sequence = TGTATATAATGTATATATAGTATATATACATTATATAAA

Gene: BH0651: Transcriptional regulator, GntR family
*2
Bacillus licheniformis DSM 13

Site:
position = -58
score = 6.99098
sequence = TGTTATAACTGTTTATATTGTATATATACAGTTATAACG

Gene: BLi02114: Transcriptional regulator, GntR family

Site:
position = -53
score = 7.46731
sequence = TGTGTATATTGTACATATTGTGTATATTGTATATAAACA

Gene: BLi00208: Transcriptional regulator, GntR family
*
Bacillus pumilus SAFR-032

Site:
position = -73
score = 8.39334
sequence = TGTATATAATGTATATATAGTATATATACAATATTTTGT

Gene: BPUM_0174: Transcriptional regulator, GntR family
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3952: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
BH0652
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579

Gene: BC4221: ABC-type multidrug transport system, ATPase component
*2
Bacillus clausii KSM-K16

Gene: ABC0261: ABC-type multidrug transport system, ATPase component

Site:
position = -195
score = 7.59427
sequence = CGTTATTTTTGTATATATATGATATATACAATATGAACA

Site:
position = -186
score = 7.00926
sequence = TGTATATATATGATATATACAATATGAACAAAATATACA

Gene: ABC3528: ABC-type multidrug transport system, ATPase component
 
Bacillus halodurans C-125

Gene: BH0652: ABC-type multidrug transport system, ATPase component
 2
Bacillus licheniformis DSM 13

Gene: BLi02113: ABC-type multidrug transport system, ATPase component

Gene: BLi00207: ABC-type multidrug transport system, ATPase component
 
Bacillus pumilus SAFR-032

Gene: BPUM_0175: ABC-type multidrug transport system, ATPase component
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -49
score = 5.91824
sequence = GTGATATATTGTGTATACACGACATACACAATTTGATCG

Gene: Pjdr2_3954: ABC-type multidrug transport system, ATPase component
ABC-type multidrug transport system, ATPase component
BH0653
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 4
Bacillus cereus ATCC 14579

Gene: BC4217: ABC-type multidrug transport system, permease component

Gene: BC4218: ABC-type multidrug transport system, permease component

Gene: BC4219: ABC-type multidrug transport system, permease component

Gene: BC4220: ABC-type multidrug transport system, permease component
 2
Bacillus clausii KSM-K16

Gene: ABC3527: ABC-type multidrug transport system, permease component

Gene: ABC0262: ABC-type multidrug transport system, permease component
 
Bacillus halodurans C-125

Gene: BH0653: ABC-type multidrug transport system, permease component
 2
Bacillus licheniformis DSM 13

Gene: BLi02112: ABC-type multidrug transport system, permease component

Gene: BLi00206: ABC-type multidrug transport system, permease component
 
Bacillus pumilus SAFR-032

Gene: BPUM_0176: ABC-type multidrug transport system, permease component
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3953: ABC-type multidrug transport system, permease component
ABC-type multidrug transport system, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD