Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ABC3918 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process:
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16 5 1
Bacillus halodurans C-125 5 1
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2 5 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ABC3919
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
*
Bacillus clausii KSM-K16

Site:
position = -52
score = 7.25006
sequence = AATACTGTGTATGTAGATATAAACAGATGA

Gene: ABC3919: hypothetical protein
*
Bacillus halodurans C-125

Site:
position = -49
score = 7.25006
sequence = TATACTGTGTATATAGATATTAACACATAA

Gene: BH1163: hypothetical protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -59
score = 7.87036
sequence = TATACTGTGTATAAGGATATACACAGTATA

Gene: Pjdr2_5298: hypothetical protein
hypothetical protein
ABC3918
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3918: Transcriptional regulator, GntR family
 
Bacillus halodurans C-125

Gene: BH1164: Transcriptional regulator, GntR family
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5297: Transcriptional regulator, GntR family
Transcriptional regulator, GntR family
ABC3917
 
Anoxybacillus flavithermus WK1
 
Bacillus amyloliquefaciens FZB42
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3917: ABC transporter, ATP-binding protein
 
Bacillus halodurans C-125

Gene: BH1165: ABC transporter, ATP-binding protein
 
Bacillus licheniformis DSM 13
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168
 
Geobacillus kaustophilus HTA426
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5296: ABC transporter, ATP-binding protein
ABC transporter, ATP-binding protein
ABC3916
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1274: ABC transporter, ATP-binding protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_010130: ABC transporter, ATP-binding protein
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3916: ABC transporter, ATP-binding protein
 
Bacillus halodurans C-125

Gene: BH1166: ABC transporter, ATP-binding protein
 
Bacillus licheniformis DSM 13

Gene: BLi01066: ABC transporter, ATP-binding protein
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU09890: ABC transporter, ATP-binding protein
 
Geobacillus kaustophilus HTA426

Gene: GK0644: ABC transporter, ATP-binding protein
 
Oceanobacillus iheyensis HTE831

Gene: OB1138: ABC transporter, ATP-binding protein
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5295: ABC transporter, ATP-binding protein
ABC transporter, ATP-binding protein
ABC3915
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1275: Putative ABC-type Na+ efflux pump, permease component
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_010140: Putative ABC-type Na+ efflux pump, permease component
 
Bacillus cereus ATCC 14579
 
Bacillus clausii KSM-K16

Gene: ABC3915: Putative ABC-type Na+ efflux pump, permease component
 
Bacillus halodurans C-125

Gene: BH1167: Putative ABC-type Na+ efflux pump, permease component
 
Bacillus licheniformis DSM 13

Gene: BLi01067: Putative ABC-type Na+ efflux pump, permease component
 
Bacillus pumilus SAFR-032
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU09900: Putative ABC-type Na+ efflux pump, permease component
 
Geobacillus kaustophilus HTA426

Gene: GK0645: Putative ABC-type Na+ efflux pump, permease component
 
Oceanobacillus iheyensis HTE831

Gene: OB1139: Putative ABC-type Na+ efflux pump, permease component
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5294: Putative ABC-type Na+ efflux pump, permease component
Putative ABC-type Na+ efflux pump, permease component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD