Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PdxR3 - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680 4 4
Streptomyces coelicolor A3(2) 4 2
Streptomyces griseus subsp. griseus NBRC 13350 6 4
Streptomyces scabiei 87.22 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pdxR3
*
Streptomyces avermitilis MA-4680

Site:
position = -31
score = 5.4764
sequence = TGGCCAATTCCGGGAAGGTGGACT

Gene: SAV_6928: Transcriptional regulator, GntR/MocR family
*
Streptomyces coelicolor A3(2)

Site:
position = -31
score = 5.55687
sequence = TGGCCAATTTGGGGAAGGTGGACT

Gene: SCO1417: Transcriptional regulator, GntR/MocR family
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -31
score = 4.97163
sequence = TGGCCAATTCGAGGAAGGTGGACT

Gene: SGR_6115: Transcriptional regulator, GntR/MocR family
*
Streptomyces scabiei 87.22

Site:
position = -30
score = 5.25534
sequence = TGGCCAATTCGGGGAAGGTGGACT

Gene: SCAB_75881: Transcriptional regulator, GntR/MocR family
Transcriptional regulator, GntR/MocR family
 
CRON 2.
pdxR3
*
Streptomyces avermitilis MA-4680

Site:
position = -25
score = 3.83658
sequence = TAGCCAGATTGGCTAGGCTGGTTC

Gene: SAV_980: Transcriptional regulator, GntR/MocR family
 
Streptomyces coelicolor A3(2)
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -25
score = 3.8006
sequence = TAGCCAGATTGGCTACGCTGGTCC

Gene: SGR_4328: Transcriptional regulator, GntR/MocR family
 
Streptomyces scabiei 87.22
Transcriptional regulator, GntR/MocR family
 
CRON 3.
COG2364
*2
Streptomyces avermitilis MA-4680

Site:
position = -129
score = 3.83658
sequence = GAACCAGCCTAGCCAATCTGGCTA

Gene: SAV_7578: Predicted membrane protein

Site:
position = 9
score = 5.4764
sequence = AGTCCACCTTCCCGGAATTGGCCA

Gene: SAV_6929: Predicted membrane protein
*
Streptomyces coelicolor A3(2)

Site:
position = -95
score = 5.55687
sequence = AGTCCACCTTCCCCAAATTGGCCA

Gene: SCO1418: Predicted membrane protein
*2
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -95
score = 4.97163
sequence = AGTCCACCTTCCTCGAATTGGCCA

Gene: SGR_6114: Predicted membrane protein

Site:
position = -129
score = 3.8006
sequence = GGACCAGCGTAGCCAATCTGGCTA

Gene: SGR_4327: Predicted membrane protein
*
Streptomyces scabiei 87.22

Site:
position = -92
score = 5.25534
sequence = AGTCCACCTTCCCCGAATTGGCCA

Gene: SCAB_75871: Predicted membrane protein
Predicted membrane protein
COG0584
 
Streptomyces avermitilis MA-4680

Gene: SAV_6927: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
 
Streptomyces coelicolor A3(2)

Gene: SCO1419: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_6113: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
 
Streptomyces scabiei 87.22

Gene: SCAB_75861: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
COG2270
 
Streptomyces avermitilis MA-4680

Gene: SAV_6926: Permeases of the major facilitator superfamily
 
Streptomyces coelicolor A3(2)

Gene: SCO1420: Permeases of the major facilitator superfamily
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_6112: Permeases of the major facilitator superfamily
 
Streptomyces scabiei 87.22

Gene: SCAB_75851: Permeases of the major facilitator superfamily
Permeases of the major facilitator superfamily
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD