Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SCO3812 - Streptomycetaceae

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux
Effector:
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Streptomyces avermitilis MA-4680
Streptomyces coelicolor A3(2) 2 1
Streptomyces griseus subsp. griseus NBRC 13350 2 1
Streptomyces scabiei 87.22
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
SCO3813
 
Streptomyces avermitilis MA-4680
 
Streptomyces coelicolor A3(2)

Gene: SCO3813: putative membrane protein
*
Streptomyces griseus subsp. griseus NBRC 13350

Site:
position = -116
score = 5.52812
sequence = TTGTTCTACTAGCATGCGAACAA

Gene: SGR_2260: putative membrane protein
 
Streptomyces scabiei 87.22
putative membrane protein
SCO3812
 
Streptomyces avermitilis MA-4680
*
Streptomyces coelicolor A3(2)

Site:
position = -22
score = 5.4609
sequence = TGGTGATAGTTTCATTAGCACCA

Gene: SCO3812: Transcriptional regulator, GntR family
 
Streptomyces griseus subsp. griseus NBRC 13350

Gene: SGR_2259: Transcriptional regulator, GntR family
 
Streptomyces scabiei 87.22
Transcriptional regulator, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD