Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR2 - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Methylobacillus flagellatus KT
Methylophilales bacterium HTCC2181
Methylotenera mobilis JLW8
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans
Azoarcus sp. EbN1
Dechloromonas aromatica RCB
Thauera sp. MZ1T
Neisseria meningitidis MC58
Laribacter hongkongensis HLHK9
Chromobacterium violaceum ATCC 12472 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruB
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
*
Chromobacterium violaceum ATCC 12472

Site:
position = -186
score = 4.39398
sequence = CTGAGAAATCGTTTTCAATT

Site:
position = -53
score = 4.8896
sequence = AAATGTAATCGTTTTCAATG

Gene: CV3052: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Chromobacterium violaceum ATCC 12472

Gene: CV3053: 1-phosphofructokinase (EC 2.7.1.56)
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
 
Chromobacterium violaceum ATCC 12472

Gene: CV3054: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
CRON 2.
fruR2
 
Methylobacillus flagellatus KT
 
Methylophilales bacterium HTCC2181
 
Methylotenera mobilis JLW8
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Azoarcus sp. EbN1
 
Dechloromonas aromatica RCB
 
Thauera sp. MZ1T
 
Neisseria meningitidis MC58
 
Laribacter hongkongensis HLHK9
*
Chromobacterium violaceum ATCC 12472

Site:
position = -155
score = 4.8896
sequence = CATTGAAAACGATTACATTT

Site:
position = -22
score = 4.39398
sequence = AATTGAAAACGATTTCTCAG

Gene: CV3051: Transcriptional regulator for fructose utilization, LacI family
Transcriptional regulator for fructose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD