Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR2 - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 4 2
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1 4 2
Leptothrix cholodnii SP-6
Methylibium petroleiphilum PM1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR2
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -206
score = 4.3283
sequence = ATTTGGTATCGATTCCAGAC

Site:
position = -16
score = 4.02907
sequence = TCATGGAATCGTTACCATGC

Gene: Aave_4253: Transcriptional regulator for fructose utilization, LacI family
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -127
score = 5.23354
sequence = TTTTGGGAACGTTCCCAACC

Site:
position = -17
score = 4.50315
sequence = CAACGGGAACGATTGCATTG

Gene: Daci_2662: Transcriptional regulator for fructose utilization, LacI family
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
Transcriptional regulator for fructose utilization, LacI family
 
CRON 2.
fruB
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -225
score = 4.02907
sequence = GCATGGTAACGATTCCATGA

Site:
position = -35
score = 4.3283
sequence = GTCTGGAATCGATACCAAAT

Gene: Aave_4252: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -108
score = 4.50315
sequence = CAATGCAATCGTTCCCGTTG

Site:
position = 2
score = 5.23354
sequence = GGTTGGGAACGTTCCCAAAA

Gene: Daci_2663: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4251: 1-phosphofructokinase (EC 2.7.1.56)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_2664: 1-phosphofructokinase (EC 2.7.1.56)
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
1-phosphofructokinase (EC 2.7.1.56)
fruA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4250: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_2665: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Leptothrix cholodnii SP-6
 
Methylibium petroleiphilum PM1
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD