Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/Gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 1 1
Shewanella putrefaciens CN-32 2 2
Shewanella sp W3-18-1 2 2
Shewanella sp ANA-3 2 2
Shewanella sp MR-4 2 2
Shewanella sp MR-7 2 2
Shewanella baltica OS155 2 2
Shewanella denitrificans OS217 2 1
Shewanella frigidimarina NCIMB 400
Shewanella amazonensis SB2B 3 2
Shewanella loihica PV-4
Shewanella pealeana ATCC 700345 2 2
Shewanella halifaxensis HAW-EB4 2 2
Shewanella piezotolerans WP3 2 2
Shewanella sediminis HAW-EB3 2 2
Shewanella woodyi ATCC 51908 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
copZ
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -114
score = 5.51577
sequence = ACCTTGCCATTATGGGAAGGT

Gene: Sama_1787: Copper chaperone
 
Shewanella loihica PV-4
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Copper chaperone
 
CRON 2.
copA
*
Shewanella oneidensis MR-1

Site:
position = -65
score = 6.46434
sequence = ACTCTCCCGTGATGGGAGACT

Gene: SO_1689: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella putrefaciens CN-32

Site:
position = -65
score = 6.46434
sequence = ACTCTCCCGTGATGGGAGACT

Gene: Sputcn32_1408: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella sp W3-18-1

Site:
position = -65
score = 6.46434
sequence = ACTCTCCCGTGATGGGAGACT

Gene: Sputw3181_2693: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella sp ANA-3

Site:
position = -65
score = 6.46434
sequence = ACTCTCCCGTGATGGGAGACT

Gene: Shewana3_2761: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella sp MR-4

Site:
position = -65
score = 6.46434
sequence = ACTCTCCCGTGATGGGAGACT

Gene: Shewmr4_2587: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella sp MR-7

Site:
position = -65
score = 6.46434
sequence = ACTCTCCCGTGATGGGAGACT

Gene: Shewmr7_2654: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella baltica OS155

Site:
position = -65
score = 6.18621
sequence = ACTCTCCCGCAATGGGAGACT

Gene: Sbal_1505: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella denitrificans OS217

Site:
position = -61
score = 5.13402
sequence = ACCTTACCATGATGGCAAGCT

Gene: Sden_3691: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Shewanella frigidimarina NCIMB 400
*
Shewanella amazonensis SB2B

Site:
position = -67
score = 5.51577
sequence = ACCTTCCCATAATGGCAAGGT

Gene: Sama_1786: Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -63
score = 5.10353
sequence = ACTCTCCCCCTGTAGGAGACA

Gene: Spea_2772: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -62
score = 5.99392
sequence = ACTCTCCCCTTATGGGAGACA

Gene: Shal_2867: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella piezotolerans WP3

Site:
position = -73
score = 5.99392
sequence = ACTCTCCCCTTATGGGAGACA

Gene: swp_3377: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella sediminis HAW-EB3

Site:
position = -80
score = 5.99392
sequence = ACTCTCCCATTAGGGGAGACA

Gene: Ssed_1485: Copper-translocating P-type ATPase (EC 3.6.3.4)
*
Shewanella woodyi ATCC 51908

Site:
position = -81
score = 5.8006
sequence = ACCCTCCCATAAGGGGAGACA

Gene: Swoo_3191: Copper-translocating P-type ATPase (EC 3.6.3.4)
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR
 
Shewanella oneidensis MR-1

Gene: SO_1687: Copper-responsive transcriptional regulator, MerR family
*
Shewanella putrefaciens CN-32

Site:
position = -86
score = 6.46434
sequence = AGTCTCCCATCACGGGAGAGT

Gene: Sputcn32_1407: Copper-responsive transcriptional regulator, MerR family
*
Shewanella sp W3-18-1

Site:
position = -86
score = 6.46434
sequence = AGTCTCCCATCACGGGAGAGT

Gene: Sputw3181_2694: Copper-responsive transcriptional regulator, MerR family
*
Shewanella sp ANA-3

Site:
position = -92
score = 6.46434
sequence = AGTCTCCCATCACGGGAGAGT

Gene: Shewana3_2762: Copper-responsive transcriptional regulator, MerR family
*
Shewanella sp MR-4

Site:
position = -104
score = 6.46434
sequence = AGTCTCCCATCACGGGAGAGT

Gene: Shewmr4_2588: Copper-responsive transcriptional regulator, MerR family
*
Shewanella sp MR-7

Site:
position = -104
score = 6.46434
sequence = AGTCTCCCATCACGGGAGAGT

Gene: Shewmr7_2655: Copper-responsive transcriptional regulator, MerR family
*
Shewanella baltica OS155

Site:
position = -105
score = 6.18621
sequence = AGTCTCCCATTGCGGGAGAGT

Gene: Sbal_1504: Copper-responsive transcriptional regulator, MerR family
 
Shewanella denitrificans OS217

Gene: Sden_3690: Copper-responsive transcriptional regulator, MerR family
 
Shewanella frigidimarina NCIMB 400
 
Shewanella amazonensis SB2B

Gene: Sama_1785: Copper-responsive transcriptional regulator, MerR family
 
Shewanella loihica PV-4
*
Shewanella pealeana ATCC 700345

Site:
position = -57
score = 5.10353
sequence = TGTCTCCTACAGGGGGAGAGT

Gene: Spea_2773: Copper-responsive transcriptional regulator, MerR family
*
Shewanella halifaxensis HAW-EB4

Site:
position = -81
score = 5.99392
sequence = TGTCTCCCATAAGGGGAGAGT

Gene: Shal_2868: Copper-responsive transcriptional regulator, MerR family
*
Shewanella piezotolerans WP3

Site:
position = -58
score = 5.99392
sequence = TGTCTCCCATAAGGGGAGAGT

Gene: swp_3378: Copper-responsive transcriptional regulator, MerR family
*
Shewanella sediminis HAW-EB3

Site:
position = -81
score = 5.99392
sequence = TGTCTCCCCTAATGGGAGAGT

Gene: Ssed_1484: Copper-responsive transcriptional regulator, MerR family
*
Shewanella woodyi ATCC 51908

Site:
position = -60
score = 5.8006
sequence = TGTCTCCCCTTATGGGAGGGT

Gene: Swoo_3192: Copper-responsive transcriptional regulator, MerR family
Copper-responsive transcriptional regulator, MerR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD