Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CueR2 - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1
Shewanella putrefaciens CN-32 2 1
Shewanella sp W3-18-1
Shewanella sp ANA-3
Shewanella sp MR-4
Shewanella sp MR-7
Shewanella baltica OS155
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400 2 1
Shewanella amazonensis SB2B
Shewanella loihica PV-4 2 1
Shewanella pealeana ATCC 700345
Shewanella halifaxensis HAW-EB4
Shewanella piezotolerans WP3
Shewanella sediminis HAW-EB3
Shewanella woodyi ATCC 51908
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cueR2
 
Shewanella oneidensis MR-1
*
Shewanella putrefaciens CN-32

Site:
position = -66
score = 6.05367
sequence = AGCTGTGTGTTACACACAGAG

Gene: Sputcn32_0271: Copper-responsive transcriptional regulator, MerR family
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
*
Shewanella frigidimarina NCIMB 400

Site:
position = -101
score = 6.03991
sequence = ACATGGGTGTAAGACATAGGT

Gene: Sfri_0211: Copper-responsive transcriptional regulator, MerR family
 
Shewanella amazonensis SB2B
*
Shewanella loihica PV-4

Site:
position = -66
score = 6.75103
sequence = ACCTGTGTCTAACACACAGGT

Gene: Shew_3819: Copper-responsive transcriptional regulator, MerR family
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Copper-responsive transcriptional regulator, MerR family
copA
 
Shewanella oneidensis MR-1
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_0270: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Shewanella sp W3-18-1
 
Shewanella sp ANA-3
 
Shewanella sp MR-4
 
Shewanella sp MR-7
 
Shewanella baltica OS155
 
Shewanella denitrificans OS217
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0212: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Shewanella amazonensis SB2B
 
Shewanella loihica PV-4

Gene: Shew_3818: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Shewanella pealeana ATCC 700345
 
Shewanella halifaxensis HAW-EB4
 
Shewanella piezotolerans WP3
 
Shewanella sediminis HAW-EB3
 
Shewanella woodyi ATCC 51908
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD