Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CalR - Shewanellaceae

Properties
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Utilization of aromatic compounds
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Shewanella oneidensis MR-1 2 1
Shewanella putrefaciens CN-32 2 1
Shewanella sp W3-18-1 2 1
Shewanella sp ANA-3 2 1
Shewanella sp MR-4 2 1
Shewanella sp MR-7 2 1
Shewanella baltica OS155 2 1
Shewanella denitrificans OS217 2 1
Shewanella frigidimarina NCIMB 400 2 1
Shewanella amazonensis SB2B 2 1
Shewanella loihica PV-4 2 1
Shewanella pealeana ATCC 700345 2 1
Shewanella halifaxensis HAW-EB4 2 1
Shewanella piezotolerans WP3 2 1
Shewanella sediminis HAW-EB3 2 1
Shewanella woodyi ATCC 51908 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
calB
*
Shewanella oneidensis MR-1

Site:
position = -78
score = 7.21699
sequence = AACCGACTAATCAGTCGGTT

Gene: SO_3683: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella putrefaciens CN-32

Site:
position = -104
score = 6.89353
sequence = AACCGACTAATCAGTCGGTA

Gene: Sputcn32_2982: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella sp W3-18-1

Site:
position = -104
score = 6.89353
sequence = AACCGACTAATCAGTCGGTA

Gene: Sputw3181_0965: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella sp ANA-3

Site:
position = -78
score = 7.21699
sequence = AACCGACTAATCAGTCGGTT

Gene: Shewana3_3251: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella sp MR-4

Site:
position = -78
score = 7.21699
sequence = AACCGACTAATCAGTCGGTT

Gene: Shewmr4_0872: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella sp MR-7

Site:
position = -78
score = 7.21699
sequence = AACCGACTAATCAGTCGGTT

Gene: Shewmr7_3150: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella baltica OS155

Site:
position = -125
score = 6.89353
sequence = AACCGACTAATCAGTCGGTA

Gene: Sbal_3332: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella denitrificans OS217

Site:
position = -45
score = 6.84078
sequence = ACCCGACTGATTAGTCGGTT

Gene: Sden_0975: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella frigidimarina NCIMB 400

Site:
position = -82
score = 7.08924
sequence = GACCGACTAATCAGTCGGTT

Gene: Sfri_0937: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella amazonensis SB2B

Site:
position = -43
score = 7.08924
sequence = GACCGACTAATCAGTCGGTT

Gene: Sama_2855: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella loihica PV-4

Site:
position = -127
score = 7.08924
sequence = GACCGACTAATCAGTCGGTT

Gene: Shew_3103: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella pealeana ATCC 700345

Site:
position = -49
score = 7.08924
sequence = GACCGACTAATCAGTCGGTT

Gene: Spea_3357: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella halifaxensis HAW-EB4

Site:
position = -49
score = 6.96148
sequence = GACCGACTAATCAGTCGGTC

Gene: Shal_3429: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella piezotolerans WP3

Site:
position = -50
score = 7.08924
sequence = GACCGACTAATCAGTCGGTT

Gene: swp_1052: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella sediminis HAW-EB3

Site:
position = -203
score = 7.08924
sequence = GACCGACTAATCAGTCGGTT

Gene: Ssed_3716: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
*
Shewanella woodyi ATCC 51908

Site:
position = -77
score = 6.55484
sequence = GACCGACCAATCAGTCGGTT

Gene: Swoo_4064: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
calR
 
Shewanella oneidensis MR-1

Gene: SO_3684: Transcriptional regulator, TetR family
 
Shewanella putrefaciens CN-32

Gene: Sputcn32_2983: Transcriptional regulator, TetR family
 
Shewanella sp W3-18-1

Gene: Sputw3181_0964: Transcriptional regulator, TetR family
 
Shewanella sp ANA-3

Gene: Shewana3_3252: Transcriptional regulator, TetR family
 
Shewanella sp MR-4

Gene: Shewmr4_0871: Transcriptional regulator, TetR family
 
Shewanella sp MR-7

Gene: Shewmr7_3151: Transcriptional regulator, TetR family
 
Shewanella baltica OS155

Gene: Sbal_3333: Transcriptional regulator, TetR family
 
Shewanella denitrificans OS217

Gene: Sden_0974: Transcriptional regulator, TetR family
 
Shewanella frigidimarina NCIMB 400

Gene: Sfri_0936: Transcriptional regulator, TetR family
 
Shewanella amazonensis SB2B

Gene: Sama_2856: Transcriptional regulator, TetR family
 
Shewanella loihica PV-4

Gene: Shew_3104: Transcriptional regulator, TetR family
 
Shewanella pealeana ATCC 700345

Gene: Spea_3358: Transcriptional regulator, TetR family
 
Shewanella halifaxensis HAW-EB4

Gene: Shal_3430: Transcriptional regulator, TetR family
 
Shewanella piezotolerans WP3

Gene: swp_1051: Transcriptional regulator, TetR family
 
Shewanella sediminis HAW-EB3

Gene: Ssed_3717: Transcriptional regulator, TetR family
 
Shewanella woodyi ATCC 51908

Gene: Swoo_4065: Transcriptional regulator, TetR family
Transcriptional regulator, TetR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD