Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EbgR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Tolumonas auensis DSM 9187
Aeromonas salmonicida subsp. salmonicida A449
Aeromonas hydrophila subsp. hydrophila ATCC 7966 4 2
Moritella sp. PE36
Psychromonas sp. CNPT3 1 1
Psychromonas ingrahamii 37
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ebgA
 
Tolumonas auensis DSM 9187
 
Aeromonas salmonicida subsp. salmonicida A449
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -326
score = 4.94468
sequence = GCTGATTTTAGTAAAATAATC

Site:
position = -65
score = 4.7576
sequence = CTGATATTTAGTAAATGTTTA

Gene: AHA_0205: Evolved beta-D-galactosidase, alpha subunit
 
Moritella sp. PE36
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
Evolved beta-D-galactosidase, alpha subunit
ebgC
 
Tolumonas auensis DSM 9187
 
Aeromonas salmonicida subsp. salmonicida A449
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0206: Evolved beta-D-galactosidase, beta subunit
 
Moritella sp. PE36
 
Psychromonas sp. CNPT3
 
Psychromonas ingrahamii 37
Evolved beta-D-galactosidase, beta subunit
ygjI
 
Tolumonas auensis DSM 9187
 
Aeromonas salmonicida subsp. salmonicida A449
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0207: predicted beta-galactoside transporter, AAP family
 
Moritella sp. PE36
 
Psychromonas sp. CNPT3

Gene: PCNPT3_06101: predicted beta-galactoside transporter, AAP family
 
Psychromonas ingrahamii 37
predicted beta-galactoside transporter, AAP family
 
CRON 2.
ebgR
 
Tolumonas auensis DSM 9187
 
Aeromonas salmonicida subsp. salmonicida A449
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -89
score = 4.90755
sequence = GTTTCTTTTAGTAAAAATGCT

Gene: AHA_0204: Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
Moritella sp. PE36
*
Psychromonas sp. CNPT3

Site:
position = -87
score = 5.38077
sequence = CTAAGTTTTAGTAAAAAACAT

Site:
position = -49
score = 4.65635
sequence = AAATAATTCAGTAATATATAC

Gene: PCNPT3_06111: Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
Psychromonas ingrahamii 37
Evolved beta-D-galactosidase transcriptional repressor, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD