Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog EbgR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 30 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Photobacterium profundum SS9 4 2
Vibrio angustum S14 4 2
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114 6 4
Vibrio harveyi ATCC BAA-1116 1 1
Vibrio parahaemolyticus RIMD 2210633 3 2
Vibrio salmonicida LFI1238
Vibrio shilonii AK1 4 2
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6 6 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ebgR
*
Photobacterium profundum SS9

Site:
position = -191
score = 5.34455
sequence = GATAATTTTACTAAAACATCA

Gene: PBPRA2083: Evolved beta-D-galactosidase transcriptional repressor, LacI family
*
Vibrio angustum S14

Site:
position = -109
score = 5.69497
sequence = AAAGTTTTTACTAAAAAAATT

Site:
position = -159
score = 4.60357
sequence = ATATTTATTATTATATTTTTT

Site:
position = -162
score = 4.51126
sequence = AATATATTTATTATTATATTT

Gene: VAS14_15119: Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio fischeri ES114

Site:
position = -92
score = 4.91491
sequence = TAAAACTTTAGTAAAAGCCAT

Gene: VF_A0348: Evolved beta-D-galactosidase transcriptional repressor, LacI family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -104
score = 5.38777
sequence = CACAGTTTTACTAAAAATTTG

Gene: VIBHAR_03334: Evolved beta-D-galactosidase transcriptional repressor, LacI family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -102
score = 5.11275
sequence = CTCGATTTTACTAAAAGTTTG

Gene: VP2402: Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -104
score = 5.10152
sequence = GCTGTTTTTACTAAAATTTTA

Gene: VSAK1_18699: Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -102
score = 4.28684
sequence = TCGATTTTTACTAAAAAAACG

Gene: VV1_1769: Evolved beta-D-galactosidase transcriptional repressor, LacI family
Evolved beta-D-galactosidase transcriptional repressor, LacI family
 
CRON 2.
ebgA
*
Photobacterium profundum SS9

Site:
position = -53
score = 4.2333
sequence = AAAACTTTAACTAACATAGCT

Site:
position = -65
score = 5.85953
sequence = ATTTATTTTACTAAAACTTTA

Site:
position = -332
score = 5.51316
sequence = TTGTATTTTACTAAAATTTAA

Site:
position = -78
score = 4.27578
sequence = AACAGATTTACCAATTTATTT

Gene: PBPRA2084: Evolved beta-D-galactosidase, alpha subunit
*
Vibrio angustum S14

Site:
position = -118
score = 4.27045
sequence = AACGTTTTCACTAATTTATTT

Site:
position = -93
score = 5.7158
sequence = AAAACTTTTACTAAAATCGTT

Site:
position = -105
score = 6.05123
sequence = ATTTATTTTAGTAAAACTTTT

Gene: VAS14_15114: Evolved beta-D-galactosidase, alpha subunit
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio fischeri ES114

Site:
position = -67
score = 4.25079
sequence = GAGTTATTTACTACGATTTAT

Site:
position = -96
score = 4.45474
sequence = TAAAACTTTAGTTAATATCTT

Site:
position = -107
score = 5.74268
sequence = ATTTGTTTTACTAAAACTTTA

Gene: VF_A0347: Evolved beta-D-galactosidase, alpha subunit
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03337: Evolved beta-D-galactosidase, alpha subunit
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -168
score = 4.27045
sequence = AACGTTTTCACTAATTTATTT

Site:
position = -155
score = 6.05123
sequence = ATTTATTTTAGTAAAACTTTT

Site:
position = -143
score = 5.69517
sequence = AAAACTTTTACTAATATCTTT

Gene: VP2403: Evolved beta-D-galactosidase, alpha subunit
 
Vibrio salmonicida LFI1238
*
Vibrio shilonii AK1

Site:
position = -98
score = 6.21684
sequence = ATATATTTTAGTAAAACTTTT

Site:
position = -86
score = 5.60403
sequence = AAAACTTTTACTAAAATTACC

Gene: VSAK1_18704: Evolved beta-D-galactosidase, alpha subunit
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -95
score = 5.90566
sequence = AAAAGTTTTACTAATATATTT

Site:
position = -107
score = 5.22269
sequence = ATTCTATTTAGTAAAAGTTTT

Gene: VV1_1767: Evolved beta-D-galactosidase, alpha subunit
Evolved beta-D-galactosidase, alpha subunit
ebgC
 
Photobacterium profundum SS9

Gene: PBPRA2085: Evolved beta-D-galactosidase, beta subunit
 
Vibrio angustum S14

Gene: VAS14_15109: Evolved beta-D-galactosidase, beta subunit
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114

Gene: VF_A0346: Evolved beta-D-galactosidase, beta subunit
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03338: Evolved beta-D-galactosidase, beta subunit
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2404: Evolved beta-D-galactosidase, beta subunit
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_18709: Evolved beta-D-galactosidase, beta subunit
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1766: Evolved beta-D-galactosidase, beta subunit
Evolved beta-D-galactosidase, beta subunit
ygjI
 
Photobacterium profundum SS9

Gene: PBPRA2086: predicted beta-galactoside transporter, AAP family
 
Vibrio angustum S14

Gene: VAS14_15104: predicted beta-galactoside transporter, AAP family
 
Vibrio cholerae O1 biovar eltor str. N16961
*2
Vibrio fischeri ES114

Site:
position = -71
score = 5.34319
sequence = CTATAATTTACTAAAAGTTAC

Site:
position = -81
score = 4.8523
sequence = AAATTAATTACTATAATTTAC

Site:
position = -94
score = 5.85402
sequence = GTAACTTTTAGTAAAATTAAT

Gene: VF_A0340: predicted beta-galactoside transporter, AAP family

Gene: VF_A0345: predicted beta-galactoside transporter, AAP family
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03339: predicted beta-galactoside transporter, AAP family
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_18714: predicted beta-galactoside transporter, AAP family
 
Vibrio splendidus LGP32
 2
Vibrio vulnificus CMCP6

Gene: VV1_1765: predicted beta-galactoside transporter, AAP family

Gene: VV1_1764: predicted beta-galactoside transporter, AAP family
predicted beta-galactoside transporter, AAP family
SSF48208
 
Photobacterium profundum SS9
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio fischeri ES114

Site:
position = -45
score = 5.50685
sequence = GTTAAATTTAGTAAAACTTTA

Gene: VF_A0338: putative glucosyl hydrolase precursor
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV1_1763: putative glucosyl hydrolase precursor
putative glucosyl hydrolase precursor
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD