Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SgaR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Actinobacillus succinogenes 130Z
Aggregatibacter aphrophilus NJ8700
Haemophilus ducreyi 35000HP
Haemophilus influenzae Rd KW20
Haemophilus parasuis SH0165
Haemophilus somnus 2336
Mannheimia succiniciproducens MBEL55E 4 2
Pasteurella multocida subsp. multocida str. Pm70
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sgaR
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -123
score = 6.24637
sequence = CAATGATAGCGTTATCAATA

Site:
position = -89
score = 5.86991
sequence = TTGTGATAGCGGTAACATTT

Gene: MS0148: Ascorbate utilization transcriptional regulator SgaR, LacI family
 
Pasteurella multocida subsp. multocida str. Pm70
Ascorbate utilization transcriptional regulator SgaR, LacI family
 
CRON 2.
sgaA
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -65
score = 5.86991
sequence = AAATGTTACCGCTATCACAA

Site:
position = -31
score = 6.24637
sequence = TATTGATAACGCTATCATTG

Gene: MS0149: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
 
Pasteurella multocida subsp. multocida str. Pm70
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
sgaB
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1775: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0509: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1126: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0150: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
 
Pasteurella multocida subsp. multocida str. Pm70
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
sgaT
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_1774: Ascorbate-specific PTS system, EIIC component
 
Actinobacillus succinogenes 130Z

Gene: Asuc_0508: Ascorbate-specific PTS system, EIIC component
 
Aggregatibacter aphrophilus NJ8700
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336
 
Mannheimia succiniciproducens MBEL55E

Gene: MS0151: Ascorbate-specific PTS system, EIIC component
 
Pasteurella multocida subsp. multocida str. Pm70
Ascorbate-specific PTS system, EIIC component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD