Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CD0683 - Clostridia-2

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process:
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium bartlettii DSM 16795
Clostridium difficile 630 5 2
Clostridium hiranonis DSM 13275
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
CD0679
 
Clostridium bartlettii DSM 16795
*
Clostridium difficile 630

Site:
position = -119
score = 6.14191
sequence = AAATGCATATGTATTCATAA

Gene: CD0679: Hypothetical protein
 
Clostridium hiranonis DSM 13275
Hypothetical protein
 
CRON 2.
CD0680
 
Clostridium bartlettii DSM 16795
*
Clostridium difficile 630

Site:
position = -37
score = 6.33563
sequence = TTATGCATACGTATTCTGAA

Gene: CD0680: Hypothetical protein
 
Clostridium hiranonis DSM 13275
Hypothetical protein
CD0681
 
Clostridium bartlettii DSM 16795
 
Clostridium difficile 630

Gene: CD0681: Predicted transporter, MFS superfamily
 
Clostridium hiranonis DSM 13275
Predicted transporter, MFS superfamily
CD0682
 
Clostridium bartlettii DSM 16795
 
Clostridium difficile 630

Gene: CD0682: Putative sugar-sodium symporter
 
Clostridium hiranonis DSM 13275
Putative sugar-sodium symporter
CD0683
 
Clostridium bartlettii DSM 16795
 
Clostridium difficile 630

Gene: CD0683: Predicted transcriptional regulator, LacI family
 
Clostridium hiranonis DSM 13275
Predicted transcriptional regulator, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD